ID: 1089073440

View in Genome Browser
Species Human (GRCh38)
Location 11:115718245-115718267
Sequence AAAAGAACTCATGAATCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089073440_1089073444 -10 Left 1089073440 11:115718245-115718267 CCCACTGATTCATGAGTTCTTTT No data
Right 1089073444 11:115718258-115718280 GAGTTCTTTTCAGAGCGGCTGGG No data
1089073440_1089073445 9 Left 1089073440 11:115718245-115718267 CCCACTGATTCATGAGTTCTTTT No data
Right 1089073445 11:115718277-115718299 TGGGCTGCAGCAGCTGCCCAAGG No data
1089073440_1089073448 22 Left 1089073440 11:115718245-115718267 CCCACTGATTCATGAGTTCTTTT No data
Right 1089073448 11:115718290-115718312 CTGCCCAAGGGGAAGTCGCAAGG No data
1089073440_1089073447 11 Left 1089073440 11:115718245-115718267 CCCACTGATTCATGAGTTCTTTT No data
Right 1089073447 11:115718279-115718301 GGCTGCAGCAGCTGCCCAAGGGG No data
1089073440_1089073446 10 Left 1089073440 11:115718245-115718267 CCCACTGATTCATGAGTTCTTTT No data
Right 1089073446 11:115718278-115718300 GGGCTGCAGCAGCTGCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089073440 Original CRISPR AAAAGAACTCATGAATCAGT GGG (reversed) Intergenic
No off target data available for this crispr