ID: 1089073446

View in Genome Browser
Species Human (GRCh38)
Location 11:115718278-115718300
Sequence GGGCTGCAGCAGCTGCCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089073441_1089073446 9 Left 1089073441 11:115718246-115718268 CCACTGATTCATGAGTTCTTTTC No data
Right 1089073446 11:115718278-115718300 GGGCTGCAGCAGCTGCCCAAGGG No data
1089073440_1089073446 10 Left 1089073440 11:115718245-115718267 CCCACTGATTCATGAGTTCTTTT No data
Right 1089073446 11:115718278-115718300 GGGCTGCAGCAGCTGCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089073446 Original CRISPR GGGCTGCAGCAGCTGCCCAA GGG Intergenic
No off target data available for this crispr