ID: 1089073447 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:115718279-115718301 |
Sequence | GGCTGCAGCAGCTGCCCAAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1089073440_1089073447 | 11 | Left | 1089073440 | 11:115718245-115718267 | CCCACTGATTCATGAGTTCTTTT | No data | ||
Right | 1089073447 | 11:115718279-115718301 | GGCTGCAGCAGCTGCCCAAGGGG | No data | ||||
1089073441_1089073447 | 10 | Left | 1089073441 | 11:115718246-115718268 | CCACTGATTCATGAGTTCTTTTC | No data | ||
Right | 1089073447 | 11:115718279-115718301 | GGCTGCAGCAGCTGCCCAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1089073447 | Original CRISPR | GGCTGCAGCAGCTGCCCAAG GGG | Intergenic | ||
No off target data available for this crispr |