ID: 1089073447 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:115718279-115718301 |
| Sequence | GGCTGCAGCAGCTGCCCAAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1089073440_1089073447 | 11 | Left | 1089073440 | 11:115718245-115718267 | CCCACTGATTCATGAGTTCTTTT | No data | ||
| Right | 1089073447 | 11:115718279-115718301 | GGCTGCAGCAGCTGCCCAAGGGG | No data | ||||
| 1089073441_1089073447 | 10 | Left | 1089073441 | 11:115718246-115718268 | CCACTGATTCATGAGTTCTTTTC | No data | ||
| Right | 1089073447 | 11:115718279-115718301 | GGCTGCAGCAGCTGCCCAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1089073447 | Original CRISPR | GGCTGCAGCAGCTGCCCAAG GGG | Intergenic | ||
| No off target data available for this crispr | |||||