ID: 1089073500

View in Genome Browser
Species Human (GRCh38)
Location 11:115718604-115718626
Sequence CTGGAGCCAGGCTCCTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089073491_1089073500 14 Left 1089073491 11:115718567-115718589 CCGCCAACAGGCCAGTGCAGCAA No data
Right 1089073500 11:115718604-115718626 CTGGAGCCAGGCTCCTTCCTGGG No data
1089073497_1089073500 -10 Left 1089073497 11:115718591-115718613 CCTGGGCTGACAGCTGGAGCCAG No data
Right 1089073500 11:115718604-115718626 CTGGAGCCAGGCTCCTTCCTGGG No data
1089073492_1089073500 11 Left 1089073492 11:115718570-115718592 CCAACAGGCCAGTGCAGCAAGCC No data
Right 1089073500 11:115718604-115718626 CTGGAGCCAGGCTCCTTCCTGGG No data
1089073495_1089073500 3 Left 1089073495 11:115718578-115718600 CCAGTGCAGCAAGCCTGGGCTGA No data
Right 1089073500 11:115718604-115718626 CTGGAGCCAGGCTCCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089073500 Original CRISPR CTGGAGCCAGGCTCCTTCCT GGG Intergenic
No off target data available for this crispr