ID: 1089074654

View in Genome Browser
Species Human (GRCh38)
Location 11:115728570-115728592
Sequence GGCCAACTCTCTCCTTACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089074654_1089074660 26 Left 1089074654 11:115728570-115728592 CCCCAGTAAGGAGAGAGTTGGCC No data
Right 1089074660 11:115728619-115728641 GCATCGCAGCTCCCCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089074654 Original CRISPR GGCCAACTCTCTCCTTACTG GGG (reversed) Intergenic