ID: 1089074660

View in Genome Browser
Species Human (GRCh38)
Location 11:115728619-115728641
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089074656_1089074660 24 Left 1089074656 11:115728572-115728594 CCAGTAAGGAGAGAGTTGGCCAT No data
Right 1089074660 11:115728619-115728641 GCATCGCAGCTCCCCCTCCATGG No data
1089074653_1089074660 27 Left 1089074653 11:115728569-115728591 CCCCCAGTAAGGAGAGAGTTGGC No data
Right 1089074660 11:115728619-115728641 GCATCGCAGCTCCCCCTCCATGG No data
1089074658_1089074660 5 Left 1089074658 11:115728591-115728613 CCATGCGGCAGCGCCTCTTTATA No data
Right 1089074660 11:115728619-115728641 GCATCGCAGCTCCCCCTCCATGG No data
1089074654_1089074660 26 Left 1089074654 11:115728570-115728592 CCCCAGTAAGGAGAGAGTTGGCC No data
Right 1089074660 11:115728619-115728641 GCATCGCAGCTCCCCCTCCATGG No data
1089074655_1089074660 25 Left 1089074655 11:115728571-115728593 CCCAGTAAGGAGAGAGTTGGCCA No data
Right 1089074660 11:115728619-115728641 GCATCGCAGCTCCCCCTCCATGG No data
1089074659_1089074660 -8 Left 1089074659 11:115728604-115728626 CCTCTTTATATTTCTGCATCGCA No data
Right 1089074660 11:115728619-115728641 GCATCGCAGCTCCCCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089074660 Original CRISPR GCATCGCAGCTCCCCCTCCA TGG Intergenic
No off target data available for this crispr