ID: 1089077016

View in Genome Browser
Species Human (GRCh38)
Location 11:115746321-115746343
Sequence CACTGGGTGTGAAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089077004_1089077016 12 Left 1089077004 11:115746286-115746308 CCACGTGCCCCCAGTGACACACA No data
Right 1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG No data
1089077003_1089077016 13 Left 1089077003 11:115746285-115746307 CCCACGTGCCCCCAGTGACACAC No data
Right 1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG No data
1089077007_1089077016 3 Left 1089077007 11:115746295-115746317 CCCAGTGACACACATCCTGCCGG No data
Right 1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG No data
1089077009_1089077016 2 Left 1089077009 11:115746296-115746318 CCAGTGACACACATCCTGCCGGC No data
Right 1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG No data
1089077005_1089077016 5 Left 1089077005 11:115746293-115746315 CCCCCAGTGACACACATCCTGCC No data
Right 1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG No data
1089077002_1089077016 17 Left 1089077002 11:115746281-115746303 CCATCCCACGTGCCCCCAGTGAC No data
Right 1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG No data
1089077006_1089077016 4 Left 1089077006 11:115746294-115746316 CCCCAGTGACACACATCCTGCCG No data
Right 1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089077016 Original CRISPR CACTGGGTGTGAAGTGAGGA TGG Intergenic
No off target data available for this crispr