ID: 1089079505

View in Genome Browser
Species Human (GRCh38)
Location 11:115764056-115764078
Sequence TTTTCTTTCCTGAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089079505_1089079509 7 Left 1089079505 11:115764056-115764078 CCAACCTCCTTCAGGAAAGAAAA No data
Right 1089079509 11:115764086-115764108 AACAACAAAACCCAACAGCACGG No data
1089079505_1089079511 11 Left 1089079505 11:115764056-115764078 CCAACCTCCTTCAGGAAAGAAAA No data
Right 1089079511 11:115764090-115764112 ACAAAACCCAACAGCACGGAGGG No data
1089079505_1089079510 10 Left 1089079505 11:115764056-115764078 CCAACCTCCTTCAGGAAAGAAAA No data
Right 1089079510 11:115764089-115764111 AACAAAACCCAACAGCACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089079505 Original CRISPR TTTTCTTTCCTGAAGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr