ID: 1089082150

View in Genome Browser
Species Human (GRCh38)
Location 11:115785456-115785478
Sequence GTGTACACACAAATACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089082150_1089082155 19 Left 1089082150 11:115785456-115785478 CCCAGCTGTATTTGTGTGTACAC No data
Right 1089082155 11:115785498-115785520 GCAAGTTAGCAGCCACTTTGAGG No data
1089082150_1089082153 -7 Left 1089082150 11:115785456-115785478 CCCAGCTGTATTTGTGTGTACAC No data
Right 1089082153 11:115785472-115785494 TGTACACATGATGTGGTGCCAGG No data
1089082150_1089082156 20 Left 1089082150 11:115785456-115785478 CCCAGCTGTATTTGTGTGTACAC No data
Right 1089082156 11:115785499-115785521 CAAGTTAGCAGCCACTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089082150 Original CRISPR GTGTACACACAAATACAGCT GGG (reversed) Intergenic
No off target data available for this crispr