ID: 1089082326

View in Genome Browser
Species Human (GRCh38)
Location 11:115787313-115787335
Sequence CTGCTGTTCTTGGAGCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089082324_1089082326 1 Left 1089082324 11:115787289-115787311 CCAGCATGGTGCTGAGGACTGAC No data
Right 1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089082326 Original CRISPR CTGCTGTTCTTGGAGCAAAA TGG Intergenic
No off target data available for this crispr