ID: 1089090635

View in Genome Browser
Species Human (GRCh38)
Location 11:115871871-115871893
Sequence ACCTCTCAGGTCCCACCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089090635_1089090638 -4 Left 1089090635 11:115871871-115871893 CCAGAAGGTGGGACCTGAGAGGT No data
Right 1089090638 11:115871890-115871912 AGGTCAGGTGTGTATTATAAAGG No data
1089090635_1089090642 28 Left 1089090635 11:115871871-115871893 CCAGAAGGTGGGACCTGAGAGGT No data
Right 1089090642 11:115871922-115871944 AGAAAGGAGAGAGATTCTGTGGG No data
1089090635_1089090640 12 Left 1089090635 11:115871871-115871893 CCAGAAGGTGGGACCTGAGAGGT No data
Right 1089090640 11:115871906-115871928 ATAAAGGGCAGAAAAGAGAAAGG No data
1089090635_1089090641 27 Left 1089090635 11:115871871-115871893 CCAGAAGGTGGGACCTGAGAGGT No data
Right 1089090641 11:115871921-115871943 GAGAAAGGAGAGAGATTCTGTGG No data
1089090635_1089090639 -3 Left 1089090635 11:115871871-115871893 CCAGAAGGTGGGACCTGAGAGGT No data
Right 1089090639 11:115871891-115871913 GGTCAGGTGTGTATTATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089090635 Original CRISPR ACCTCTCAGGTCCCACCTTC TGG (reversed) Intergenic
No off target data available for this crispr