ID: 1089090637

View in Genome Browser
Species Human (GRCh38)
Location 11:115871884-115871906
Sequence TAATACACACCTGACCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089090637_1089090640 -1 Left 1089090637 11:115871884-115871906 CCTGAGAGGTCAGGTGTGTATTA No data
Right 1089090640 11:115871906-115871928 ATAAAGGGCAGAAAAGAGAAAGG No data
1089090637_1089090642 15 Left 1089090637 11:115871884-115871906 CCTGAGAGGTCAGGTGTGTATTA No data
Right 1089090642 11:115871922-115871944 AGAAAGGAGAGAGATTCTGTGGG No data
1089090637_1089090641 14 Left 1089090637 11:115871884-115871906 CCTGAGAGGTCAGGTGTGTATTA No data
Right 1089090641 11:115871921-115871943 GAGAAAGGAGAGAGATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089090637 Original CRISPR TAATACACACCTGACCTCTC AGG (reversed) Intergenic