ID: 1089090638

View in Genome Browser
Species Human (GRCh38)
Location 11:115871890-115871912
Sequence AGGTCAGGTGTGTATTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089090635_1089090638 -4 Left 1089090635 11:115871871-115871893 CCAGAAGGTGGGACCTGAGAGGT No data
Right 1089090638 11:115871890-115871912 AGGTCAGGTGTGTATTATAAAGG No data
1089090633_1089090638 2 Left 1089090633 11:115871865-115871887 CCTGAACCAGAAGGTGGGACCTG No data
Right 1089090638 11:115871890-115871912 AGGTCAGGTGTGTATTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089090638 Original CRISPR AGGTCAGGTGTGTATTATAA AGG Intergenic
No off target data available for this crispr