ID: 1089090642

View in Genome Browser
Species Human (GRCh38)
Location 11:115871922-115871944
Sequence AGAAAGGAGAGAGATTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089090635_1089090642 28 Left 1089090635 11:115871871-115871893 CCAGAAGGTGGGACCTGAGAGGT No data
Right 1089090642 11:115871922-115871944 AGAAAGGAGAGAGATTCTGTGGG No data
1089090637_1089090642 15 Left 1089090637 11:115871884-115871906 CCTGAGAGGTCAGGTGTGTATTA No data
Right 1089090642 11:115871922-115871944 AGAAAGGAGAGAGATTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089090642 Original CRISPR AGAAAGGAGAGAGATTCTGT GGG Intergenic
No off target data available for this crispr