ID: 1089094312

View in Genome Browser
Species Human (GRCh38)
Location 11:115906185-115906207
Sequence GCTGCCCAGCTCCCCCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089094309_1089094312 10 Left 1089094309 11:115906152-115906174 CCGAGGTCAGAGGTTGCCATTTC No data
Right 1089094312 11:115906185-115906207 GCTGCCCAGCTCCCCCAAACTGG No data
1089094311_1089094312 -6 Left 1089094311 11:115906168-115906190 CCATTTCAATATCTGAGGCTGCC No data
Right 1089094312 11:115906185-115906207 GCTGCCCAGCTCCCCCAAACTGG No data
1089094306_1089094312 27 Left 1089094306 11:115906135-115906157 CCAGGAATGTGGAAGGACCGAGG No data
Right 1089094312 11:115906185-115906207 GCTGCCCAGCTCCCCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089094312 Original CRISPR GCTGCCCAGCTCCCCCAAAC TGG Intergenic
No off target data available for this crispr