ID: 1089094368

View in Genome Browser
Species Human (GRCh38)
Location 11:115906536-115906558
Sequence GTGGAGGGCCCCTCTATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089094368_1089094383 25 Left 1089094368 11:115906536-115906558 CCATTAATAGAGGGGCCCTCCAC No data
Right 1089094383 11:115906584-115906606 GCCTAAAACGGGGGTCACTCGGG No data
1089094368_1089094385 30 Left 1089094368 11:115906536-115906558 CCATTAATAGAGGGGCCCTCCAC No data
Right 1089094385 11:115906589-115906611 AAACGGGGGTCACTCGGGAGAGG No data
1089094368_1089094380 16 Left 1089094368 11:115906536-115906558 CCATTAATAGAGGGGCCCTCCAC No data
Right 1089094380 11:115906575-115906597 AGCCTTCGTGCCTAAAACGGGGG No data
1089094368_1089094382 24 Left 1089094368 11:115906536-115906558 CCATTAATAGAGGGGCCCTCCAC No data
Right 1089094382 11:115906583-115906605 TGCCTAAAACGGGGGTCACTCGG No data
1089094368_1089094377 13 Left 1089094368 11:115906536-115906558 CCATTAATAGAGGGGCCCTCCAC No data
Right 1089094377 11:115906572-115906594 GGCAGCCTTCGTGCCTAAAACGG No data
1089094368_1089094371 -8 Left 1089094368 11:115906536-115906558 CCATTAATAGAGGGGCCCTCCAC No data
Right 1089094371 11:115906551-115906573 CCCTCCACTGCTGCCCCAGGAGG No data
1089094368_1089094378 14 Left 1089094368 11:115906536-115906558 CCATTAATAGAGGGGCCCTCCAC No data
Right 1089094378 11:115906573-115906595 GCAGCCTTCGTGCCTAAAACGGG No data
1089094368_1089094379 15 Left 1089094368 11:115906536-115906558 CCATTAATAGAGGGGCCCTCCAC No data
Right 1089094379 11:115906574-115906596 CAGCCTTCGTGCCTAAAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089094368 Original CRISPR GTGGAGGGCCCCTCTATTAA TGG (reversed) Intergenic
No off target data available for this crispr