ID: 1089094373

View in Genome Browser
Species Human (GRCh38)
Location 11:115906555-115906577
Sequence GCTGCCTCCTGGGGCAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089094373_1089094380 -3 Left 1089094373 11:115906555-115906577 CCACTGCTGCCCCAGGAGGCAGC No data
Right 1089094380 11:115906575-115906597 AGCCTTCGTGCCTAAAACGGGGG No data
1089094373_1089094383 6 Left 1089094373 11:115906555-115906577 CCACTGCTGCCCCAGGAGGCAGC No data
Right 1089094383 11:115906584-115906606 GCCTAAAACGGGGGTCACTCGGG No data
1089094373_1089094379 -4 Left 1089094373 11:115906555-115906577 CCACTGCTGCCCCAGGAGGCAGC No data
Right 1089094379 11:115906574-115906596 CAGCCTTCGTGCCTAAAACGGGG No data
1089094373_1089094382 5 Left 1089094373 11:115906555-115906577 CCACTGCTGCCCCAGGAGGCAGC No data
Right 1089094382 11:115906583-115906605 TGCCTAAAACGGGGGTCACTCGG No data
1089094373_1089094378 -5 Left 1089094373 11:115906555-115906577 CCACTGCTGCCCCAGGAGGCAGC No data
Right 1089094378 11:115906573-115906595 GCAGCCTTCGTGCCTAAAACGGG No data
1089094373_1089094385 11 Left 1089094373 11:115906555-115906577 CCACTGCTGCCCCAGGAGGCAGC No data
Right 1089094385 11:115906589-115906611 AAACGGGGGTCACTCGGGAGAGG No data
1089094373_1089094377 -6 Left 1089094373 11:115906555-115906577 CCACTGCTGCCCCAGGAGGCAGC No data
Right 1089094377 11:115906572-115906594 GGCAGCCTTCGTGCCTAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089094373 Original CRISPR GCTGCCTCCTGGGGCAGCAG TGG (reversed) Intergenic
No off target data available for this crispr