ID: 1089094378

View in Genome Browser
Species Human (GRCh38)
Location 11:115906573-115906595
Sequence GCAGCCTTCGTGCCTAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089094366_1089094378 16 Left 1089094366 11:115906534-115906556 CCCCATTAATAGAGGGGCCCTCC No data
Right 1089094378 11:115906573-115906595 GCAGCCTTCGTGCCTAAAACGGG No data
1089094372_1089094378 -2 Left 1089094372 11:115906552-115906574 CCTCCACTGCTGCCCCAGGAGGC No data
Right 1089094378 11:115906573-115906595 GCAGCCTTCGTGCCTAAAACGGG No data
1089094367_1089094378 15 Left 1089094367 11:115906535-115906557 CCCATTAATAGAGGGGCCCTCCA No data
Right 1089094378 11:115906573-115906595 GCAGCCTTCGTGCCTAAAACGGG No data
1089094368_1089094378 14 Left 1089094368 11:115906536-115906558 CCATTAATAGAGGGGCCCTCCAC No data
Right 1089094378 11:115906573-115906595 GCAGCCTTCGTGCCTAAAACGGG No data
1089094370_1089094378 -1 Left 1089094370 11:115906551-115906573 CCCTCCACTGCTGCCCCAGGAGG No data
Right 1089094378 11:115906573-115906595 GCAGCCTTCGTGCCTAAAACGGG No data
1089094373_1089094378 -5 Left 1089094373 11:115906555-115906577 CCACTGCTGCCCCAGGAGGCAGC No data
Right 1089094378 11:115906573-115906595 GCAGCCTTCGTGCCTAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089094378 Original CRISPR GCAGCCTTCGTGCCTAAAAC GGG Intergenic
No off target data available for this crispr