ID: 1089096353

View in Genome Browser
Species Human (GRCh38)
Location 11:115923090-115923112
Sequence CTCCCCGGTGGCAATTAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089096346_1089096353 4 Left 1089096346 11:115923063-115923085 CCTGTTACCTGCGTGAACTCTGC No data
Right 1089096353 11:115923090-115923112 CTCCCCGGTGGCAATTAGCCGGG No data
1089096347_1089096353 -3 Left 1089096347 11:115923070-115923092 CCTGCGTGAACTCTGCCCTTCTC No data
Right 1089096353 11:115923090-115923112 CTCCCCGGTGGCAATTAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089096353 Original CRISPR CTCCCCGGTGGCAATTAGCC GGG Intergenic
No off target data available for this crispr