ID: 1089098845

View in Genome Browser
Species Human (GRCh38)
Location 11:115942914-115942936
Sequence CTGTTGTTTTGGAGAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089098845_1089098848 -4 Left 1089098845 11:115942914-115942936 CCTTCAGCTCTCCAAAACAACAG 0: 1
1: 0
2: 0
3: 24
4: 250
Right 1089098848 11:115942933-115942955 ACAGAAATGATCAAAGATGGAGG 0: 1
1: 0
2: 3
3: 39
4: 524
1089098845_1089098847 -7 Left 1089098845 11:115942914-115942936 CCTTCAGCTCTCCAAAACAACAG 0: 1
1: 0
2: 0
3: 24
4: 250
Right 1089098847 11:115942930-115942952 ACAACAGAAATGATCAAAGATGG 0: 1
1: 0
2: 5
3: 56
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089098845 Original CRISPR CTGTTGTTTTGGAGAGCTGA AGG (reversed) Intergenic
900800862 1:4736203-4736225 CTGTGGTTTAGGAGAACTGATGG - Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
903475663 1:23617646-23617668 AAGTTGTTGTGGTGAGCTGAAGG - Intronic
904691614 1:32297370-32297392 GTGTTGTTTTGTAGAGCTGGGGG - Intronic
905135011 1:35792381-35792403 CTGATGTTTTGTAGAGATGGGGG + Intergenic
905340556 1:37274698-37274720 CTGTTGTCTAGGAGACCTCATGG - Intergenic
905380003 1:37555155-37555177 CTGTGCTTTGGGAGAGATGATGG - Intergenic
906745429 1:48218173-48218195 CTGTTGCTTATGAGAGGTGAGGG + Intergenic
909855254 1:80521380-80521402 AATTTGTTTTGGAGAGTTGAAGG - Intergenic
910627354 1:89322362-89322384 CTGTTGTTTTGGGGAAAGGAGGG - Intergenic
915139611 1:153759108-153759130 CTATTTTTTTGTAGAGATGAGGG - Intronic
915440064 1:155940373-155940395 CAGTTCCTTTGGAGTGCTGAGGG - Intergenic
915831878 1:159139076-159139098 GTGGTGTTTTGGAGACTTGAAGG - Intronic
916265335 1:162885108-162885130 CTCATGTTTTGGAGAGGTTATGG + Intergenic
916456130 1:164972579-164972601 CTTTTGTTTTGTAGATCTGATGG - Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
916984986 1:170181535-170181557 ATTTTGTTTTGGAGAGGGGATGG - Intergenic
917073395 1:171177539-171177561 CTGTTTTTTGGGAGAGCTTTGGG + Intergenic
917505718 1:175625220-175625242 CTGTTGTTTTTCACAGTTGAGGG - Intronic
917755036 1:178090529-178090551 CTATTTTTTTGTAGAGATGAGGG + Intergenic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
923427017 1:233881012-233881034 CTCTGGTTTTGCAGAGCTGAGGG + Intergenic
924077898 1:240360315-240360337 CTGTTGGTTTGCAGATGTGATGG - Intronic
924448818 1:244159367-244159389 CTGTTAGTTTAGGGAGCTGAAGG + Intergenic
1062816067 10:500967-500989 GTTTTCTTTTGGAGAGCGGAGGG + Intronic
1063292506 10:4763881-4763903 CTGTTGGCTTGGGGAGCTGGAGG - Intergenic
1063731814 10:8706378-8706400 CTCTAGATTTTGAGAGCTGAGGG + Intergenic
1063854396 10:10231579-10231601 CTGGTGTTTTAGAAACCTGATGG + Intergenic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1069500862 10:68951752-68951774 GTCTTGTTTTGGATAGCTGTTGG + Intergenic
1069746027 10:70715575-70715597 CTGCTGAGGTGGAGAGCTGAAGG + Intronic
1070011667 10:72481311-72481333 TAGTTGTTTTGGAAAGCTTATGG + Intronic
1072006312 10:91252718-91252740 CTCATGTATTGGAGAGCTAAAGG - Intronic
1072425020 10:95322941-95322963 CTGTTGTTGTGGAGACTTGGTGG - Intronic
1072451873 10:95545132-95545154 CTGGAGCTTGGGAGAGCTGAGGG - Intronic
1072558894 10:96550839-96550861 CTGATGTTTTCCAGATCTGAAGG + Intronic
1073231435 10:101974440-101974462 CTGTGGCTTTTGAGACCTGATGG - Intronic
1073863476 10:107773377-107773399 CTGTGGTTTTAGAGAGCAGTTGG - Intergenic
1075555521 10:123428674-123428696 TCCTTGTTTTGGAGAGCTGGAGG + Intergenic
1077986025 11:7351884-7351906 CTGTTGTATGGGTGAGCTGGTGG + Intronic
1079761737 11:24338188-24338210 CTGGTGTTTTGCAGAACTGTAGG - Intergenic
1080103676 11:28489157-28489179 CTCTTGCTTTGGACAGCTGCTGG + Intergenic
1080792051 11:35530161-35530183 TTGGTGTTTTGCACAGCTGATGG - Intronic
1080827776 11:35862301-35862323 CTGGGGTTTTGGAGATCTTAAGG - Intergenic
1081075958 11:38673907-38673929 CTGTTGTTTTGGGTATTTGAAGG - Intergenic
1081327657 11:41765061-41765083 CTGTTGTTTTTTAAAGTTGATGG - Intergenic
1085530150 11:77187628-77187650 CTGGGGTTTTGGGGAGTTGAAGG + Intronic
1086837238 11:91640026-91640048 TTGTTGTTTTAGAAAGCTGTTGG - Intergenic
1088755122 11:112879146-112879168 CTGTTGTGATGGACAGCGGAAGG + Intergenic
1089098845 11:115942914-115942936 CTGTTGTTTTGGAGAGCTGAAGG - Intergenic
1089217578 11:116844102-116844124 CTCTTGTTTTGAAGATCAGAAGG + Intronic
1090923737 11:131231435-131231457 CTGAGGTTTTGGGGAGCTGAAGG - Intergenic
1091303103 11:134520205-134520227 CTGCTGTTTTGCAGAACTCAGGG + Intergenic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1093679957 12:21990856-21990878 CTGTTGTTGGGGATAGCTGCTGG + Intergenic
1095190457 12:39251791-39251813 CTGTTGATTTGGAGGTATGAGGG - Intergenic
1097882011 12:64694770-64694792 CTGTAGTTCTGGAAGGCTGAAGG - Exonic
1098044650 12:66387676-66387698 CTCTTGTTTTATAGAGGTGATGG - Intronic
1098957944 12:76706841-76706863 CTGTAGTTTTGGGGAGAGGAAGG + Intergenic
1099857598 12:88186562-88186584 CTGTTGTTTTGGATAGGTACTGG + Intronic
1100097806 12:91064971-91064993 CTTTTATTTTGGAAAGCTGGAGG + Intergenic
1101927386 12:108983858-108983880 CTCATGGTTTGGAGAGTTGATGG + Intronic
1106553739 13:30792677-30792699 CTGTTGTTTTTGAAAGCTGGAGG + Intergenic
1107556366 13:41519626-41519648 CTGTAATGTTGGAGAGCTGCAGG - Intergenic
1107720598 13:43244559-43244581 TTGTTGTTTTGAAGAGCTATAGG + Intronic
1108487051 13:50937395-50937417 CATTTTTTTTGGAGAGATGAGGG + Intronic
1108525439 13:51282122-51282144 CTGTGGTTTTTGAAAGTTGAAGG - Intronic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1110317273 13:74124752-74124774 CTGTTATCTTTTAGAGCTGATGG - Intronic
1110497498 13:76186377-76186399 CTGAAGCTTTGGAGAGCTAATGG + Intergenic
1110512173 13:76363589-76363611 TTGTTATTTTAGAGAGCAGAAGG - Intergenic
1114491763 14:23106796-23106818 CTGTGCTTTGGGAGAGATGAGGG - Intergenic
1114661070 14:24345164-24345186 CTTTTCCTTAGGAGAGCTGAGGG + Intergenic
1119336909 14:73840932-73840954 TTTTTTTTTTGTAGAGCTGAGGG + Intergenic
1119632609 14:76246762-76246784 CTGTCCTTTTGGAAAGCTGGGGG + Intronic
1121463775 14:94101420-94101442 CTGCTTTTCTGGAGAGGTGAGGG - Intronic
1121953530 14:98193599-98193621 ATGGTGTTTTGGGGAGTTGAGGG - Intergenic
1124819421 15:33029790-33029812 CTGTGGTTTGGGAGAACTGTGGG + Intronic
1124849276 15:33320491-33320513 TTGTTGTTTTTGACAGCTCAGGG + Intronic
1125073516 15:35584925-35584947 CAGTTGTTTTGGAGAGAGGGAGG - Intergenic
1126600484 15:50423090-50423112 TTTTTGTTTTGTAGAGATGAGGG + Intergenic
1127611799 15:60644386-60644408 CTCCTGTTTTGGGGGGCTGACGG + Intronic
1129284974 15:74517074-74517096 CTTTTGTTTTCTAGATCTGAAGG - Intergenic
1129318343 15:74759809-74759831 TTGTTGTTTTAAAGAGATGAGGG + Intergenic
1129798098 15:78393274-78393296 CTATTGTTTTATAGAGATGAGGG + Intergenic
1131115685 15:89793788-89793810 CTGTAGTTTTGGTGAGCTCCTGG - Intronic
1131983425 15:98017612-98017634 CTGCTGCTTTAGAGAGATGAGGG - Intergenic
1132405600 15:101540484-101540506 TTTTTGTTTTGTAGAGATGAGGG + Intergenic
1135406689 16:22203494-22203516 TTGTTTTTTTGTAGAGATGAGGG + Intergenic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1137663514 16:50232094-50232116 CTGTTTTTTAGAGGAGCTGATGG + Intronic
1137722023 16:50633090-50633112 CTCTGGTTTTGGAGAACTGGGGG + Intronic
1139908844 16:70384100-70384122 CTCATGTTTGGGAGACCTGAGGG - Intronic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1142614932 17:1128623-1128645 TTGCTGGTTTGGAGAGTTGATGG + Intronic
1143847411 17:9783010-9783032 CTGTGGTATTGGAGAGATGGAGG + Intronic
1144820145 17:18067094-18067116 CTGTGGTCTTGTTGAGCTGATGG + Exonic
1147451393 17:40507007-40507029 CTGTTGTGTAGGAGGGGTGAGGG + Intergenic
1149190239 17:54052666-54052688 ATGTTCTGTTGGAGAGCTTAGGG - Intergenic
1149526213 17:57357839-57357861 CTTTTTTTTTGATGAGCTGAAGG + Intronic
1151936356 17:77264302-77264324 AGGTTGTTTTGTAAAGCTGAAGG - Intergenic
1154035659 18:10799373-10799395 CTGCTGTTTTGTAGAGGTGAGGG + Intronic
1157564072 18:48668069-48668091 CTGCAGGTTTGGAGGGCTGAAGG - Intronic
1159128973 18:64258260-64258282 GTGTTGTCTTGGGAAGCTGAAGG + Intergenic
1159757046 18:72378847-72378869 CTTTTGTTTTACAGAGCTGGGGG + Intergenic
1160320920 18:77893889-77893911 CTGTAGCTTTGGAAAGCTAAGGG - Intergenic
1161016080 19:1984350-1984372 GTTTTGTTTTGGAGTGATGACGG + Intergenic
1162929507 19:13950340-13950362 TTGATGTTTTGTAGAGATGAGGG + Intronic
1164585371 19:29467988-29468010 CTGCTGGTATGGAGAGCTAAAGG - Intergenic
1164609359 19:29621682-29621704 TTGTTTTTTTGAAGAGCTGGGGG + Intergenic
1165218936 19:34298772-34298794 CTTTTGTTTGGGAGAGCAGATGG + Intronic
1166624117 19:44334609-44334631 CTGCTGTTTTCTACAGCTGAAGG + Intronic
1167017638 19:46851294-46851316 CTGGTGATTTGGAAGGCTGAGGG - Intergenic
1167718370 19:51159268-51159290 CTGTTGTCTGGGAAATCTGAGGG - Intergenic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
1167759690 19:51438095-51438117 CTGTTGTCTTGGAAATCAGAGGG + Intergenic
930640550 2:53850349-53850371 CTGTATTTGGGGAGAGCTGAGGG + Intergenic
931122567 2:59236081-59236103 TTGTTATGTGGGAGAGCTGAGGG + Intergenic
931902987 2:66810612-66810634 TTGTTGTTTTTGATACCTGAAGG - Intergenic
931929642 2:67116260-67116282 GTGTTGTACTGGAGAGCTGAAGG + Intergenic
931939965 2:67241301-67241323 CAGTTGTCTTGGAAATCTGAAGG - Intergenic
932685161 2:73862949-73862971 TGGTTGTTTTGGAAAGGTGAAGG + Exonic
932913050 2:75825001-75825023 CTGTTGTTTTGGGGTGGAGAGGG - Intergenic
936238458 2:110766913-110766935 CTCTTGTCTTGCAGAGCAGATGG - Intronic
936255842 2:110910142-110910164 CTGCTGTGGTGGAGAGGTGAGGG - Intronic
936417896 2:112336022-112336044 CTGTTGTTTCTAAGAGCTGGTGG - Exonic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
938073613 2:128320616-128320638 CTGCTCTTTTGGAGACCTGCTGG + Intergenic
939332811 2:140786758-140786780 CTTGTGTCATGGAGAGCTGAAGG + Intronic
939837552 2:147149860-147149882 GTGTTGTTCTGCAGAGCTGGTGG + Intergenic
941645308 2:168034046-168034068 CTCTTGTTTAGGATAGGTGAAGG - Intronic
942147520 2:173041311-173041333 CTTTTGTGTTGGAGAGCTCTGGG - Intronic
943731545 2:191307963-191307985 CTGTTTTTTTGGGGAGATGGAGG - Intronic
944205037 2:197149614-197149636 CTGCTGCTTTGGAGAACTAAAGG - Intronic
945448586 2:209967270-209967292 CTGATGTGTGGGAGAGCAGAGGG + Intronic
945662044 2:212698496-212698518 GTGTTGTTTTGAAGAACTGAGGG - Intergenic
947404181 2:229757361-229757383 CTGTAGTTTTTGGAAGCTGAAGG - Intergenic
948028000 2:234793214-234793236 TTTTTGTTTTGGTGAGCTAATGG + Intergenic
948131774 2:235606276-235606298 CTGCTGTTGTGGAGAACAGAAGG - Intronic
1171961185 20:31495988-31496010 CTGTGGTTTTGGGCAGCTAAAGG - Intergenic
1174230266 20:49040558-49040580 CTGATGTGCTGGAGAGCAGATGG + Intergenic
1175675105 20:60939604-60939626 CTGTGCTTTTGGAGACCTGCAGG - Intergenic
1177312802 21:19419340-19419362 CTGTTGTTCTGGAGAGTTCAAGG + Intergenic
1178459607 21:32790749-32790771 CTTTTTTGTTGGAGAGCTGCTGG + Exonic
1178565329 21:33678708-33678730 TTGTTGTTTTGGAGGGGTGGTGG + Intronic
1180676455 22:17589789-17589811 CTGTTTTCTTTGAGAGGTGAGGG - Intronic
1182011830 22:27007474-27007496 CTGAGGTTTGGGAGAGCAGAAGG - Intergenic
1182898846 22:33881341-33881363 CTGCTCATTTGGAGAGCTGGAGG - Intronic
1184740253 22:46423994-46424016 TTGTTGTTTTGGAGAGCATAGGG + Intronic
949958866 3:9294754-9294776 CTGTTTCTTTGGAGAGGAGAAGG - Intronic
950067759 3:10126794-10126816 TTGTTGATTTGGAGAGGTCAAGG + Exonic
950594180 3:13964477-13964499 TTAGTGTTTTGGAGACCTGAAGG - Intronic
951008521 3:17648188-17648210 CTGCTGTTTTGAAGATCAGATGG - Intronic
951641701 3:24843877-24843899 TTGTTGTTTTGGTGATTTGAGGG + Intergenic
955377888 3:58413110-58413132 GTGTCATTTGGGAGAGCTGAGGG + Intronic
955730436 3:61979979-61980001 TTGGTGTTTAGGAGGGCTGAGGG - Intronic
955821544 3:62901272-62901294 CTGGTGTTTTGGAGGGTTGTGGG - Intergenic
959343865 3:105167065-105167087 TAGTTGTTTTGAAGAGATGAAGG - Intergenic
959810588 3:110614621-110614643 CTCTCCTTTTGGAGAGATGATGG + Intergenic
959968763 3:112384885-112384907 CTGGTGTTTTTGAGAGATGAGGG - Intergenic
962477265 3:135766033-135766055 CTGTAGTATTTGAGACCTGAAGG - Intergenic
963243612 3:143036877-143036899 CTGTTGTTTTGCAGGGGTGGGGG - Intronic
964225112 3:154389505-154389527 CACTTGCCTTGGAGAGCTGATGG + Intronic
964711101 3:159672657-159672679 TTGTTGTTTTTGTGAGGTGAGGG - Intronic
965690297 3:171349153-171349175 CTGTTTTTCTTGAGAGATGAAGG - Intronic
967836252 3:193965793-193965815 CTTCAGTTTTGGAGGGCTGAGGG + Intergenic
969438427 4:7201925-7201947 CTGTAGCTTTGGAAAGGTGAAGG + Intronic
969696301 4:8737028-8737050 CTGTGTTTCTGGACAGCTGATGG - Intergenic
973597602 4:52508373-52508395 CTGTTGTTTTGGTGAGTTAGAGG - Intergenic
973793376 4:54398640-54398662 CTGTTGTTTTGGAAAGCCAGTGG + Intergenic
973906301 4:55535103-55535125 CTATTTTTTTGGAGAGCCAAAGG + Intronic
975857266 4:78637731-78637753 CAGCAGTTTGGGAGAGCTGAAGG + Intergenic
978678904 4:111354254-111354276 GTGTTGGTTTTGAGAGGTGAGGG + Intergenic
979388164 4:120094668-120094690 CTGTTTCTATGGAGTGCTGAAGG + Intergenic
979585644 4:122412938-122412960 CTGCTGTTTTGTAGAGCTGTTGG + Intronic
981076080 4:140593724-140593746 CGGTTGTTTTGTAGACTTGATGG + Intergenic
981402005 4:144323810-144323832 CAGTTGTTATGTAGACCTGATGG - Intergenic
986199082 5:5565130-5565152 CCCTGGTTTTGCAGAGCTGAGGG - Intergenic
986625340 5:9718611-9718633 GTTTTGTTTTGTAGAGATGAGGG - Intergenic
986986800 5:13509615-13509637 ATGGTGTTTTGCAGGGCTGAGGG - Intergenic
987141984 5:14955775-14955797 TTGTTGTTTTGTAGAGATGGGGG + Intergenic
990815862 5:59784181-59784203 TTGTTCTCTTGGAGAGCTGTGGG - Intronic
990968356 5:61474989-61475011 ATGTGCTTTTGGAGGGCTGAAGG - Intronic
992084933 5:73269914-73269936 AGGTTGTTTTGGAGAGTTGGTGG - Intergenic
993383300 5:87232928-87232950 ATGTAGTTCTGGAAAGCTGATGG + Intergenic
994153376 5:96474989-96475011 GTGTTGTTTTGGTGAGAAGAAGG + Intergenic
994648709 5:102500449-102500471 CTTTTGCTTTGGATAGCAGAAGG - Intergenic
995910743 5:117183615-117183637 CTGGTGTTTTGGAGGGATGTGGG + Intergenic
999261310 5:150240596-150240618 CTCCTGGCTTGGAGAGCTGAGGG - Intronic
1000158479 5:158575546-158575568 CTGAAGCTTTGGAGAGCTGATGG + Intergenic
1000229925 5:159306365-159306387 TTTTTGTTTTGTAGAGCTGGGGG - Intergenic
1000540012 5:162527956-162527978 CTGTTATTGTGGAGAGAGGAAGG + Intergenic
1000580221 5:163027036-163027058 TTGTTTGTTTGGAGGGCTGAAGG + Intergenic
1000599253 5:163252463-163252485 CTTTAGCTTTGGAGAGCTGGTGG - Intergenic
1001976991 5:176008215-176008237 CTGATGTTTGGGAGAACTGTGGG - Intronic
1002240437 5:177835565-177835587 CTGATGTTTGGGAGAACTGCGGG + Intergenic
1002284311 5:178152094-178152116 CTGTAGTCCTGGAGAGGTGATGG - Intronic
1004044226 6:12011139-12011161 GTGTTGGTTTGGAGAGTGGAAGG - Intronic
1004053017 6:12107833-12107855 CTGCTGATTGGTAGAGCTGAGGG + Intronic
1004163734 6:13236997-13237019 CTGTTGTTTTGCAAAAATGAAGG + Intronic
1004164764 6:13247116-13247138 CTGTTGTTTTAATGAGTTGAAGG - Intronic
1004751685 6:18568296-18568318 ATGTTTTTTTGGGAAGCTGAAGG + Intergenic
1005352391 6:24949284-24949306 CTTGTTTTTTGGAGAGCTGGCGG - Intronic
1005477447 6:26221591-26221613 CAGTTGTGTTAGAGAGCTAAGGG - Intergenic
1007054507 6:38868983-38869005 AGGTTGTTTTGAATAGCTGATGG + Intronic
1008174552 6:48251606-48251628 CTAGTGTTTTGAAGAGCTGCGGG + Intergenic
1008467229 6:51844315-51844337 CAGTTTTTTTGGAAAGCTCATGG - Intronic
1008844720 6:55949624-55949646 CTGGTGCTTTGGAGCTCTGAGGG - Intergenic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1011524863 6:88253598-88253620 ATATTGTTATGGAGAACTGAAGG + Intergenic
1012801172 6:103830778-103830800 GTTTTGTTTTGTAGAGCAGAGGG + Intergenic
1013968104 6:115980572-115980594 CAGTTGGTTTGGAAAGCAGAGGG - Intronic
1014620089 6:123657106-123657128 CATTTGTTTTGGTGAGATGAGGG - Intergenic
1014657578 6:124127609-124127631 CTGATGGTTTGGTGAGCAGAGGG + Intronic
1015039045 6:128694074-128694096 ATGTTATTTTGGAGAGATAAAGG - Intergenic
1016711606 6:147179499-147179521 CTGATGTTTTAAAGAGATGAGGG - Intergenic
1017471094 6:154737501-154737523 TTGTTGTTTTGTAGAGATGGGGG - Intronic
1019012267 6:168851363-168851385 CCATTGTTTTGGGGAGCAGAAGG + Intergenic
1019288116 7:233884-233906 GTGTTGTTTTTCAGAGCTGAGGG + Intronic
1019368772 7:649872-649894 CTGTTTTTTTGTAGAGCTTGAGG + Intronic
1021039329 7:15842278-15842300 CTGCTGCTTTGGAAAGCTGTAGG + Intergenic
1023994812 7:45152842-45152864 CTGTTGGTTTGGAAAGCTCAGGG - Intergenic
1024038273 7:45527119-45527141 CCTTGGTTTTGGAGAGATGAAGG - Intergenic
1025620153 7:63161920-63161942 CTGTAGTTTTTGAGAACTGAAGG - Intergenic
1031571785 7:123368414-123368436 CTGTTATTTTGAAGAACAGAGGG + Intergenic
1035309635 7:157957255-157957277 CTGTTGCTGTGGAGAGGGGATGG - Intronic
1036473924 8:9076116-9076138 TTGTTGTTTTGTAGAGACGAGGG + Intronic
1039291669 8:36101996-36102018 TTTTTTTTTTGGAGAGATGAGGG + Intergenic
1041154069 8:54965750-54965772 CTGCTGCTTGGGAGAGGTGAAGG - Intergenic
1041409190 8:57534625-57534647 CTGTTGTCTGGGAGATCAGAAGG - Intergenic
1041677776 8:60553025-60553047 CTGTGCTTTTTGAGAGGTGATGG + Intronic
1041812532 8:61927561-61927583 CTTTTATTTTAGAGAGATGAAGG + Intergenic
1042359105 8:67862202-67862224 CTGATACTTTGGAGAGCTGGAGG - Intergenic
1042658909 8:71132629-71132651 CTGTTGTATGAGAGAGCTGTTGG + Intergenic
1044704864 8:94998875-94998897 CTGGTGTTTTGGGGAATTGAAGG + Intronic
1045444178 8:102242920-102242942 CTTTTCTTTTGGAGAACTGCTGG + Intergenic
1047017354 8:120737627-120737649 CTGTTGATTTGTATGGCTGAGGG + Intronic
1047382344 8:124374856-124374878 CTGTTCTGTTACAGAGCTGAGGG - Intergenic
1047768842 8:128014031-128014053 CTGTTGTTCTGGTGAGCAGTGGG + Intergenic
1048222683 8:132556546-132556568 CTGCTGTTTCTGAGAGCAGAAGG + Intergenic
1048397060 8:134023803-134023825 CTGTGGTTTTGTAGAACTGTTGG - Intergenic
1049672230 8:143875056-143875078 CTGCAGATTTGGGGAGCTGAGGG - Intronic
1049700954 8:144012314-144012336 CTGGTGGCATGGAGAGCTGAGGG + Intronic
1050363795 9:4855482-4855504 CTGCTGCTGTGGAGAGCTGTTGG + Intronic
1050755166 9:8993315-8993337 CTGTTGTTTTGGAAATTTAAAGG + Intronic
1052163276 9:25291176-25291198 TTGTTGTTTTGTAGAGGTGCTGG - Intergenic
1054873438 9:70070462-70070484 GTGGGGTTTTGTAGAGCTGATGG - Intronic
1055601477 9:77923604-77923626 TTATTGTTTTGGAGATCTCAAGG - Intronic
1055649621 9:78394539-78394561 CTGTTGTTTGGAAGTGCTCAGGG + Intergenic
1055998182 9:82184738-82184760 CTGTTGTTTTGAAGATGAGAGGG + Intergenic
1056388111 9:86116161-86116183 CTGTGGTTTTGGCGAGCACAGGG - Intergenic
1058282871 9:103138847-103138869 GTGTATTTTTGGAGAGTTGAAGG + Intergenic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1062123059 9:134844298-134844320 CTTTTCTTTTGAAGAGATGAAGG - Exonic
1185774475 X:2791515-2791537 CTGTGGTTTTGGAGACTTGCAGG - Intronic
1186039781 X:5463102-5463124 CTGTGCTTTAGGAGAGCTGGTGG + Intergenic
1186465743 X:9783363-9783385 TTGTCCTTTTGGAAAGCTGAGGG - Intronic
1187027487 X:15451000-15451022 CCTGTGATTTGGAGAGCTGATGG - Intronic
1188503450 X:30854735-30854757 TTGATGCTGTGGAGAGCTGAAGG + Exonic
1188801821 X:34541618-34541640 TTGTTTTTTAGGAAAGCTGAAGG - Intergenic
1189466152 X:41279063-41279085 TTGATGTTTTGCAGAGATGAGGG + Intergenic
1190256102 X:48763504-48763526 CTTTTTTTTTGTAGAGGTGAGGG - Intronic
1190453147 X:50600884-50600906 CTTTTATTTGGGAGAGCAGATGG - Intronic
1193600113 X:83501207-83501229 CTGTTCTTTTGGAGAGCCCTGGG - Intergenic
1193643658 X:84041521-84041543 ATGTTGAATAGGAGAGCTGAAGG + Intergenic
1194971506 X:100349022-100349044 CTGGTGCTTTGGGAAGCTGATGG - Intronic
1196340847 X:114595397-114595419 TTGTTGTTTTGTAGAAATGAGGG + Intronic
1196468707 X:116000041-116000063 TTCTTGTTTTGGGGAGTTGAAGG + Intergenic
1196521356 X:116676416-116676438 GTGTTGTGTTGGAGAGCAGAGGG + Intergenic
1197633313 X:128886880-128886902 CTGTTTTATTGGAGAAGTGAAGG - Intergenic
1197720056 X:129739024-129739046 CTTTTGTTTTGGAGGGCTCTGGG - Exonic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic