ID: 1089099576

View in Genome Browser
Species Human (GRCh38)
Location 11:115951136-115951158
Sequence AGGAAGCCTGCCTTGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089099574_1089099576 -7 Left 1089099574 11:115951120-115951142 CCACTCCTGGGCTCTGAGGAAGC 0: 1
1: 8
2: 6
3: 36
4: 399
Right 1089099576 11:115951136-115951158 AGGAAGCCTGCCTTGTTTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 209
1089099569_1089099576 29 Left 1089099569 11:115951084-115951106 CCTCATAGAAAATTACTTGACTT No data
Right 1089099576 11:115951136-115951158 AGGAAGCCTGCCTTGTTTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 209
1089099573_1089099576 -6 Left 1089099573 11:115951119-115951141 CCCACTCCTGGGCTCTGAGGAAG 0: 1
1: 2
2: 17
3: 51
4: 382
Right 1089099576 11:115951136-115951158 AGGAAGCCTGCCTTGTTTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089099576 Original CRISPR AGGAAGCCTGCCTTGTTTTG AGG Intergenic
900341442 1:2191188-2191210 AGGCAGCGTCCCTTGTTTGGGGG + Intronic
900711119 1:4115011-4115033 AGGAAGCTTCTCTTGTCTTGAGG + Intergenic
901879143 1:12184158-12184180 AGAATGCTTGCCATGTTTTGGGG + Intronic
902988179 1:20168421-20168443 AGCAAGCCTGTCTTGTTTGAGGG - Intronic
905222370 1:36457314-36457336 AGCAAGACTGCCTTGTTTCAAGG + Intronic
906490899 1:46267642-46267664 AGGAGCCCTGCCTTGTCTTTGGG + Intronic
906538723 1:46568377-46568399 AGGAAGCCACCCTTGCTTTCAGG - Intronic
907369459 1:53991479-53991501 AGGAGTGCTGCCTTGTTGTGAGG - Intergenic
907931783 1:59007474-59007496 TGTATGCCTGCCTTGTTTTTGGG - Intergenic
907968417 1:59356443-59356465 AGGAAGCCTTCCTTGACTTAGGG + Intronic
911990077 1:104684999-104685021 ATGGAGCATGCCATGTTTTGGGG - Intergenic
914688483 1:150003960-150003982 AGGAAGCTTTCCTCATTTTGGGG - Intronic
916578768 1:166089587-166089609 ATGAAGCATGGCCTGTTTTGAGG + Intronic
916678178 1:167081774-167081796 AGGGAGCCTGCCATCTGTTGAGG - Intronic
919639896 1:200037221-200037243 AGAAACCCTGCCTTGGCTTGAGG - Intronic
920987291 1:210902466-210902488 AGGAAGCTGGCTCTGTTTTGAGG + Intronic
922367322 1:224878238-224878260 AGGAAGCCTGCCTTGGGGTCGGG - Intergenic
924458937 1:244240957-244240979 AAGAAGCCTGCCTTTTTGTTGGG - Intergenic
924494326 1:244572004-244572026 AGGAATTCTGCATTGTGTTGTGG - Intronic
1065908793 10:30283430-30283452 TGGAAGCCTGCCTTCTGTTGGGG - Intergenic
1067016454 10:42759174-42759196 ATGAAGCCAGCCTTGTTTAGGGG + Intergenic
1073479882 10:103779743-103779765 AGGAAGTCTGCCCAGATTTGAGG + Intronic
1073605050 10:104886160-104886182 AGTAAGACTGACTTGATTTGTGG + Intronic
1074668732 10:115762305-115762327 AGAAAGCCTGCCTGGTCTTTTGG + Intronic
1075081768 10:119388910-119388932 AGAAAGCCAGCCATGTTGTGAGG - Intronic
1076337275 10:129716028-129716050 AGGAAGTCTGCTCTGTCTTGAGG - Intronic
1076644015 10:131939100-131939122 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644020 10:131939137-131939159 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644025 10:131939174-131939196 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644030 10:131939211-131939233 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644035 10:131939248-131939270 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644040 10:131939285-131939307 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644045 10:131939322-131939344 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644050 10:131939359-131939381 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644055 10:131939396-131939418 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644060 10:131939433-131939455 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644065 10:131939470-131939492 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1076644070 10:131939507-131939529 ATGCAGCCTGCCGTGTTTTCTGG - Intronic
1079095390 11:17506639-17506661 AGAAAGCCTGGCATTTTTTGAGG - Intronic
1082037165 11:47654310-47654332 AAGAAGCCTGGCATGTTTTGAGG + Intergenic
1082740188 11:56902265-56902287 ATAAGCCCTGCCTTGTTTTGGGG + Intergenic
1084322174 11:68379437-68379459 AGGAAGCCTGCGGTGCTTTACGG + Intronic
1084794779 11:71497837-71497859 AACAAGCCTCCCTTTTTTTGAGG + Intronic
1087962601 11:104370684-104370706 AGGAAGCATGCCTTATATGGTGG - Intergenic
1089099576 11:115951136-115951158 AGGAAGCCTGCCTTGTTTTGAGG + Intergenic
1090082470 11:123623187-123623209 AGGAAGGCTGCATTGTGTGGTGG + Intronic
1092124143 12:6064059-6064081 AGGAAGCCTTCCTTTCTTGGAGG + Intronic
1094601849 12:31915858-31915880 AGGATGGCTTCATTGTTTTGGGG + Intergenic
1096827895 12:54293503-54293525 AGGAAGCTTCCCGTGATTTGTGG - Intronic
1099397108 12:82154163-82154185 AGGAGGACTGTCTTGTTGTGGGG - Intergenic
1101407190 12:104438994-104439016 AGGGAGACTGCCTTTTTCTGGGG - Intergenic
1104105157 12:125652064-125652086 AGGATGCCTGCCCTGTTTTAAGG + Intronic
1104490740 12:129190683-129190705 AGCAGGGCTGCCTTGTTTTCTGG - Intronic
1105008058 12:132735457-132735479 AGGAAGCCTGCTTTCTCTCGAGG + Exonic
1107363960 13:39650380-39650402 AGGAAGAGTGCCATGTTATGAGG + Intergenic
1107431722 13:40346226-40346248 AGGAAGCCTGCCTGGGGTTTTGG + Intergenic
1107850372 13:44566139-44566161 ATGAAGCCTGCCTATTTTTTAGG + Intronic
1108216740 13:48192803-48192825 AGGAAGCCTAGCTTTTTTTTAGG - Intergenic
1108456222 13:50616683-50616705 TGGCCGCCTGGCTTGTTTTGAGG + Intronic
1108691156 13:52860431-52860453 AGGAAGCCAGCCCTGTCTTAGGG - Intergenic
1109198854 13:59409133-59409155 AAACAGCCTACCTTGTTTTGGGG - Intergenic
1112867810 13:103928394-103928416 AGGGAGTCTACCTTGTCTTGTGG - Intergenic
1113120064 13:106916468-106916490 AACAACCCTGCCTTTTTTTGGGG - Intergenic
1113362245 13:109642391-109642413 AGGAAGCCTCCCTTGTTGAGGGG - Intergenic
1113579742 13:111420620-111420642 AGGCAGCCTGCCTTCTTTCTAGG - Intergenic
1113801076 13:113086482-113086504 AGGAAGCGTCCCTTGCTTGGAGG + Intronic
1115875057 14:37852001-37852023 AGGTAGCCTGGGTTGTATTGTGG - Intronic
1115881859 14:37928228-37928250 ATGTAGCTGGCCTTGTTTTGGGG - Intronic
1117060101 14:51953645-51953667 AGCAAGCCTGCCTGGCTCTGAGG - Intronic
1117650816 14:57903048-57903070 ATGGAGCTTGCCTTCTTTTGGGG - Intronic
1120685135 14:87529210-87529232 AGGGAGCCTGGTTTGTTTGGTGG - Intergenic
1120942949 14:89966692-89966714 AGGAAGCCTGCCTTTCTTCAGGG - Intronic
1121582819 14:95043857-95043879 AGGAAGCCTGCTGGGGTTTGTGG + Intergenic
1125138296 15:36370053-36370075 AGGAAAACTGCCTTTTTTTGGGG + Intergenic
1127209171 15:56754678-56754700 ATGAAGCTTGCCTCATTTTGGGG - Intronic
1130022170 15:80240884-80240906 AGGAAGCCAGCTTTGTCCTGGGG - Intergenic
1131446509 15:92502441-92502463 AGGAAGTCTAGCTTGTCTTGTGG - Intergenic
1132549763 16:549526-549548 AAGCAGCCGGCCTTGTTTTCGGG - Intronic
1132728047 16:1347246-1347268 AGGGAGCCTGGCTTGTGCTGGGG - Intronic
1133236446 16:4389435-4389457 AGGAAGCTGGCCATGGTTTGGGG - Intronic
1133747925 16:8701657-8701679 AGGGAGCTTGCATTGTTCTGGGG + Intronic
1134415417 16:14039265-14039287 AGGAAGCCAGCCATGTTGTGAGG - Intergenic
1134617606 16:15663584-15663606 AGGAAGCCTTCCTTGACTTTCGG + Intronic
1136038032 16:27555483-27555505 ATGAAGCCTACCTTGTTTTGTGG + Intronic
1136369236 16:29825638-29825660 TGGACTCCTGCCTTGTTCTGAGG - Intronic
1136688065 16:32007698-32007720 AGGAAATCTGCCTTGCTTTATGG - Intergenic
1136788669 16:32951253-32951275 AGGAAATCTGCCTTGCTTTATGG - Intergenic
1136881143 16:33902681-33902703 AGGAAATCTGCCTTGCTTTATGG + Intergenic
1139643969 16:68313992-68314014 AGGAAGTCAGTATTGTTTTGTGG + Intronic
1140379073 16:74470235-74470257 AGGAAGCCTGCCTGTTGTAGGGG - Intronic
1140554134 16:75901273-75901295 TTGAAGCCTGCCTTGTTTTCTGG + Intergenic
1140652476 16:77103498-77103520 ATGAGACCTGCCTTTTTTTGTGG - Intergenic
1141536882 16:84687820-84687842 AGGGATCATGCCTTGTGTTGAGG + Intergenic
1203090866 16_KI270728v1_random:1212742-1212764 AGGAAATCTGCCTTGCTTTATGG - Intergenic
1142571284 17:876285-876307 TGGGAGCCTGCCTTTTTTTCTGG - Intronic
1142855999 17:2730793-2730815 GAGGAGCCTGGCTTGTTTTGGGG + Intergenic
1143169375 17:4918604-4918626 AAGAACCTTGTCTTGTTTTGGGG + Intergenic
1144892702 17:18503312-18503334 AGGGCGCCTGCCCTGCTTTGGGG + Intergenic
1145139512 17:20440975-20440997 AGGGCGCCTGCCCTGCTTTGGGG - Intergenic
1145307339 17:21682592-21682614 AGGACGCCTGCTGTGTTCTGCGG + Intergenic
1145307792 17:21684922-21684944 AGGACGCCTGCTGTGTTCTGTGG + Intergenic
1146000793 17:29129153-29129175 AGGAGGCCTGGCATGTCTTGGGG - Intronic
1146454926 17:33002000-33002022 GGGAGGCCTCCCTTGTTATGAGG + Intergenic
1148151405 17:45398385-45398407 ATGAGGCCTGCCATGTTCTGTGG - Intronic
1152112218 17:78363277-78363299 ATGTAAGCTGCCTTGTTTTGGGG + Intergenic
1153258664 18:3199184-3199206 GGGAAGACTGACTTGATTTGGGG + Intronic
1153498871 18:5728045-5728067 AGGATGGCTGCCTTGATTTTTGG + Intergenic
1153971886 18:10234536-10234558 AGGAAGCCTTCCTTGCTTCTGGG + Intergenic
1155982446 18:32195768-32195790 AGGGAGCCAGTCTTTTTTTGTGG + Intronic
1156008264 18:32469371-32469393 AAGAAGCCTGCCCTGCTGTGGGG - Intronic
1157458095 18:47855882-47855904 ATGAAGACTCCCTTGTTATGTGG + Intronic
1159032177 18:63242659-63242681 AGAATGCCCTCCTTGTTTTGTGG - Intronic
1163649463 19:18508937-18508959 AGGCAGCAAGCCTTGTTGTGGGG + Intronic
1167074483 19:47240262-47240284 AGGACGCCTGGGTTGTTTTCTGG - Intergenic
926798752 2:16640516-16640538 AGGCAGCCTGCCTAGATTTATGG + Intronic
927115582 2:19898613-19898635 AGGAAGCCAGCCTGGCATTGGGG - Intronic
927141188 2:20131906-20131928 AGGAAGGCTGCCTTGTGTTTTGG - Intergenic
927314971 2:21671192-21671214 AGGAAGCCTGCCCTGCTCTTGGG - Intergenic
927881920 2:26694929-26694951 GGGGAGCATGCCTTGTTGTGGGG - Intronic
928897763 2:36284491-36284513 AAGAAGCTTGCCTTCTTCTGTGG - Intergenic
930059005 2:47273096-47273118 AGGAAGTCTGCCTTGACTTTTGG + Intergenic
930232795 2:48859674-48859696 AGGAAGTTAGTCTTGTTTTGAGG + Intergenic
931021971 2:58056097-58056119 AGGAAGCGTGCCCTCTTTTAGGG - Intronic
932463956 2:71901519-71901541 AGAAAGGCTGCCATGTTGTGGGG - Intergenic
932879542 2:75488382-75488404 AGGGAGTCTGCCTTGTTATTGGG - Intronic
936768525 2:115883881-115883903 AGGAAGTCTTCCATGTTTTGAGG - Intergenic
940728926 2:157367444-157367466 AGGAAACTTGCCTTGTTTATAGG + Intergenic
942466452 2:176212466-176212488 AGGAAGCCTGCATTGTGTGCAGG - Intergenic
947254731 2:228149525-228149547 AGGATACCTGCCTTGTGTGGAGG + Intronic
947637033 2:231685396-231685418 AGGAAGCATGGCTTGGATTGGGG + Intergenic
949001852 2:241619301-241619323 AGTAAGTGTGCCTTGTTTGGAGG - Intronic
1171570852 20:26250575-26250597 AGGATGCCTGCTGTGTTCTGGGG + Intergenic
1172986547 20:38996027-38996049 AGCATGCCTGGGTTGTTTTGAGG - Intronic
1176025525 20:62983390-62983412 AGGAAGCCTTCCTTCTTCTCAGG + Intergenic
1176108113 20:63399070-63399092 AGGAAGCCTGCCTGGTTGCAGGG - Intergenic
1177957852 21:27623109-27623131 AGGAAGCCAGCCTTAGTGTGAGG - Intergenic
1178076293 21:29016013-29016035 AGGAATCCTGCTCTGTTCTGTGG - Intronic
1180573012 22:16747594-16747616 AGGATGCCTGCTGTGTTCTGGGG + Intergenic
1182419725 22:30243105-30243127 TGGAAGGCTGTCTTCTTTTGAGG - Exonic
950174661 3:10864533-10864555 AGGAAGCCTGCCCTGTAAAGAGG - Intronic
951472608 3:23072158-23072180 AGATTGCCTACCTTGTTTTGGGG - Intergenic
952586955 3:34904651-34904673 AGGAGGCCTGCCTGCCTTTGTGG + Intergenic
952882003 3:37991200-37991222 AGGAGCCCTTCCTTCTTTTGTGG - Intronic
953427439 3:42806522-42806544 TGGTAGTCTGCCTTGTTTTGTGG - Intronic
953498927 3:43413919-43413941 ATGAAGGCTGCCTTCTCTTGTGG - Intronic
953581323 3:44159762-44159784 ATGAAGACTGCATTGATTTGAGG - Intergenic
954192584 3:48974506-48974528 AGAAAGCCTGCCTTCTTGAGAGG - Intronic
954991558 3:54844758-54844780 AGGAGTCCTGCCTTCTTTTGAGG + Intronic
955499389 3:59569306-59569328 GGGAAGCTTGCCTTGCTTTGAGG - Intergenic
958437593 3:94116458-94116480 AGGAAAACTGGATTGTTTTGTGG - Intronic
960354228 3:116631231-116631253 ATGCAGCTTTCCTTGTTTTGGGG + Intronic
962943398 3:140145961-140145983 AAGAAGCCTACCTTGTTTCTGGG + Intronic
971545896 4:27886449-27886471 AGAAACCCTGCCTTATTTAGTGG + Intergenic
973683010 4:53340486-53340508 AGGAAGGCCTCCTTGATTTGTGG - Intronic
973844876 4:54901429-54901451 AGGACTCCTGCCTTGGTTTGTGG - Intergenic
975530568 4:75395550-75395572 ATCAAACCTGCCTTGATTTGGGG + Intergenic
982325206 4:154122745-154122767 AGGAAGCCTGCGTCATTTTTGGG + Intergenic
983177971 4:164614227-164614249 GGGAAGTCAGCTTTGTTTTGGGG - Intergenic
986855478 5:11864143-11864165 TGGAAGCCTGCCTTTCGTTGTGG - Intronic
988149363 5:27356200-27356222 AGGAAGAGTTCCCTGTTTTGGGG - Intergenic
988560419 5:32275949-32275971 ATAAAGCCTGTATTGTTTTGGGG + Intronic
988602494 5:32652801-32652823 AGGGAGCCCCCCCTGTTTTGTGG + Intergenic
990498241 5:56369811-56369833 AGGCAGCCTGCTTTGTCCTGTGG + Intergenic
990566494 5:57034789-57034811 ACAAAGCCAGCCTTGTTTTCTGG - Intergenic
992767300 5:80013060-80013082 CAGAAACTTGCCTTGTTTTGAGG - Intronic
994273517 5:97809137-97809159 AAAAAGCCTGCCTCATTTTGGGG - Intergenic
995899646 5:117051381-117051403 GGGACGCCTGCCTTGGTTAGCGG - Intergenic
995934287 5:117489286-117489308 GGCAAGCCTGCCTTGTTTTCTGG - Intergenic
996796658 5:127355093-127355115 AGGGAAGATGCCTTGTTTTGGGG + Intronic
996840375 5:127841795-127841817 AGTAAGCATGCCTTGGTATGGGG + Intergenic
996876643 5:128248095-128248117 AGGAGGCATGACTTGTTTTAGGG + Intergenic
997580669 5:135014802-135014824 AGGAAGCAGGCCCTGTATTGTGG + Intergenic
998605557 5:143630880-143630902 AGCAAGCCTGCTTTATTTGGGGG + Intergenic
1004410323 6:15375559-15375581 AGGCACTCTGCCTTGTTCTGTGG + Intronic
1004419955 6:15460338-15460360 AGGAAGCCTGCCTTATCTTCAGG - Intronic
1004481741 6:16025988-16026010 AGGAAGCCTGCCTAGTTTCATGG + Intergenic
1007845118 6:44747973-44747995 AGGAGGCCTGCCTGCTTCTGTGG + Intergenic
1011949890 6:92952393-92952415 AGGAAGCCTGCCTCCCTCTGTGG + Intergenic
1014014461 6:116514058-116514080 AGGAAAACTGCCATGGTTTGGGG + Intronic
1014491307 6:122065158-122065180 AAGAAACCTGACTTGTTTTAGGG - Intergenic
1015314520 6:131803570-131803592 TGTAAGTCTGCCTTGCTTTGTGG - Intergenic
1017606804 6:156143590-156143612 AAGAAGCCTGCCTTGCATAGTGG - Intergenic
1018045261 6:159960230-159960252 AGGAAGCTTGCCTTGGAATGGGG - Intergenic
1020093782 7:5356462-5356484 AGGAAGCATGCCGTCTGTTGCGG - Intronic
1021058444 7:16080014-16080036 AAGAAGCCAGCCTAGATTTGAGG + Intergenic
1021930955 7:25580994-25581016 TGGACTCCTGGCTTGTTTTGGGG + Intergenic
1022629723 7:32073608-32073630 AGGAATCCTTAGTTGTTTTGTGG - Intronic
1024926366 7:54619361-54619383 AGGAAGACTGAATTGTTCTGTGG - Intergenic
1025909006 7:65812472-65812494 CGGCAGCCTGCTATGTTTTGAGG + Intergenic
1025993236 7:66511783-66511805 AGGAACCCAGCCTTGGATTGGGG - Intergenic
1026037332 7:66839381-66839403 AGGAACCCAGCCTTGGATTGGGG + Intergenic
1027214609 7:76175707-76175729 AGGAACCCAGCCTTGGATTGGGG - Intergenic
1028616107 7:92768778-92768800 TTCAAGCCTGCCTTGTTTTCTGG + Intronic
1031598894 7:123679862-123679884 AGAAAAGCTGGCTTGTTTTGAGG - Intergenic
1033843483 7:145403591-145403613 AGGAGGACTGAATTGTTTTGGGG + Intergenic
1034146834 7:148881300-148881322 AGGATACCTTCCTTCTTTTGAGG - Intronic
1034373834 7:150626607-150626629 AGGCAGCCTGCCTGGTTTATGGG - Exonic
1036935817 8:13001532-13001554 AGGAAAAATGCTTTGTTTTGGGG + Intronic
1039028834 8:33287523-33287545 AGAAAGCCTGTCCTGTTCTGGGG - Intergenic
1041407708 8:57518308-57518330 AAGAATACTGCCTTGTTATGGGG + Intergenic
1042490476 8:69391956-69391978 AGGAAACCTTACTTGTTTTCAGG - Intergenic
1042939058 8:74089276-74089298 ATGTAGCCAGTCTTGTTTTGAGG - Intergenic
1043512598 8:80964554-80964576 AGATACCCTGCCTTCTTTTGTGG + Intergenic
1044243144 8:89910712-89910734 AGGAATCCTGTCTTCTTGTGTGG + Intronic
1045857935 8:106785955-106785977 AGGAACTCTCCATTGTTTTGGGG + Intergenic
1046728713 8:117702377-117702399 AGGAAGCATGCATGCTTTTGGGG - Intergenic
1047452555 8:124978758-124978780 AGGAATCCTGCCTTCTATTCTGG - Exonic
1048091210 8:131242217-131242239 AGCAATCCTGCCTTCTTCTGAGG - Intergenic
1048463106 8:134639231-134639253 AAGAAGCCTGCCTTGGTACGGGG + Intronic
1051062711 9:13063297-13063319 GGGAAGCCTGACATGTTTTCTGG - Intergenic
1051272687 9:15370969-15370991 AGCAAGCCTGCCAGGTTTTCAGG + Intergenic
1051723980 9:20069543-20069565 AGGATGCCTGGATGGTTTTGGGG - Intergenic
1053179308 9:35954524-35954546 AACAAGCCTGCCTTCTTGTGAGG - Intergenic
1054160104 9:61667532-61667554 AGGATGCCTGCTGTGTTTTCCGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057737967 9:97683786-97683808 TGTAAGCCTTCCTTGTTGTGAGG - Intronic
1057896561 9:98913555-98913577 AGGAAGCCTACCTTCCTCTGTGG - Intergenic
1060141531 9:121214485-121214507 ATGAACCAGGCCTTGTTTTGTGG - Intronic
1061674714 9:132209285-132209307 AGGAAGCCTGACTTCTATTTTGG + Intronic
1061888483 9:133605416-133605438 TGGGAGCCTGGTTTGTTTTGGGG + Intergenic
1061895384 9:133644234-133644256 AGGAAGCCGGCCTTGCCTTCGGG + Exonic
1062290749 9:135793345-135793367 AGGAAACCTGCCTGGTGGTGGGG + Intergenic
1187028724 X:15463159-15463181 AGTAAGTCTGCCTTATTTTCAGG + Intronic
1187984837 X:24798871-24798893 AGAAAGACTGCCTAGTTTTAGGG - Intronic
1190263601 X:48814887-48814909 AGGGAGCCTGCCTTACCTTGGGG - Exonic
1190778247 X:53572543-53572565 CGTAAGGGTGCCTTGTTTTGTGG - Intronic
1196071531 X:111528825-111528847 AGAAAGTCTGCCCTATTTTGGGG - Intergenic
1198217531 X:134569679-134569701 AGGGAGGCTGCCCTGCTTTGAGG - Intronic