ID: 1089100255

View in Genome Browser
Species Human (GRCh38)
Location 11:115957095-115957117
Sequence ACATAAAAGCAAAAAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089100251_1089100255 30 Left 1089100251 11:115957042-115957064 CCTGTCTGCAGTTCATGGTGTTG No data
Right 1089100255 11:115957095-115957117 ACATAAAAGCAAAAAATGGATGG No data
1089100253_1089100255 -4 Left 1089100253 11:115957076-115957098 CCAAAAACTATTGACTGAGACAT No data
Right 1089100255 11:115957095-115957117 ACATAAAAGCAAAAAATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089100255 Original CRISPR ACATAAAAGCAAAAAATGGA TGG Intergenic
No off target data available for this crispr