ID: 1089101625

View in Genome Browser
Species Human (GRCh38)
Location 11:115967236-115967258
Sequence GTGCCGTTTTTTAAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089101625_1089101631 10 Left 1089101625 11:115967236-115967258 CCAACCAGCTTAAAAAACGGCAC No data
Right 1089101631 11:115967269-115967291 TATCTCCTGCACCTGGCTGGAGG No data
1089101625_1089101630 7 Left 1089101625 11:115967236-115967258 CCAACCAGCTTAAAAAACGGCAC No data
Right 1089101630 11:115967266-115967288 GATTATCTCCTGCACCTGGCTGG No data
1089101625_1089101632 11 Left 1089101625 11:115967236-115967258 CCAACCAGCTTAAAAAACGGCAC No data
Right 1089101632 11:115967270-115967292 ATCTCCTGCACCTGGCTGGAGGG No data
1089101625_1089101629 3 Left 1089101625 11:115967236-115967258 CCAACCAGCTTAAAAAACGGCAC No data
Right 1089101629 11:115967262-115967284 AGGAGATTATCTCCTGCACCTGG 0: 2
1: 334
2: 893
3: 1790
4: 1928

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089101625 Original CRISPR GTGCCGTTTTTTAAGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr