ID: 1089101981

View in Genome Browser
Species Human (GRCh38)
Location 11:115970669-115970691
Sequence CCGAATCCAGTATTTTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089101981_1089101985 28 Left 1089101981 11:115970669-115970691 CCTCAATAAAATACTGGATTCGG No data
Right 1089101985 11:115970720-115970742 GCTTATCCAACATGATCAAGTGG 0: 69
1: 6735
2: 2175
3: 1248
4: 1625
1089101981_1089101986 29 Left 1089101981 11:115970669-115970691 CCTCAATAAAATACTGGATTCGG No data
Right 1089101986 11:115970721-115970743 CTTATCCAACATGATCAAGTGGG 0: 82
1: 7619
2: 3862
3: 3153
4: 3227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089101981 Original CRISPR CCGAATCCAGTATTTTATTG AGG (reversed) Intergenic
No off target data available for this crispr