ID: 1089102342

View in Genome Browser
Species Human (GRCh38)
Location 11:115974050-115974072
Sequence TGGTGGGATGAATCCAAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089102342_1089102354 17 Left 1089102342 11:115974050-115974072 CCGGTCTTGGATTCATCCCACCA No data
Right 1089102354 11:115974090-115974112 TGCCTCGGTGGCAATATGAGGGG No data
1089102342_1089102352 15 Left 1089102342 11:115974050-115974072 CCGGTCTTGGATTCATCCCACCA No data
Right 1089102352 11:115974088-115974110 CCTGCCTCGGTGGCAATATGAGG No data
1089102342_1089102346 2 Left 1089102342 11:115974050-115974072 CCGGTCTTGGATTCATCCCACCA No data
Right 1089102346 11:115974075-115974097 TGTGTCTCCCCAGCCTGCCTCGG No data
1089102342_1089102353 16 Left 1089102342 11:115974050-115974072 CCGGTCTTGGATTCATCCCACCA No data
Right 1089102353 11:115974089-115974111 CTGCCTCGGTGGCAATATGAGGG No data
1089102342_1089102347 5 Left 1089102342 11:115974050-115974072 CCGGTCTTGGATTCATCCCACCA No data
Right 1089102347 11:115974078-115974100 GTCTCCCCAGCCTGCCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089102342 Original CRISPR TGGTGGGATGAATCCAAGAC CGG (reversed) Intergenic
No off target data available for this crispr