ID: 1089106297

View in Genome Browser
Species Human (GRCh38)
Location 11:116008631-116008653
Sequence CCGAATCCAGTATTTTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089106297_1089106301 28 Left 1089106297 11:116008631-116008653 CCTCAATAAAATACTGGATTCGG No data
Right 1089106301 11:116008682-116008704 GCTTATCCAACATGATCAAGTGG 0: 69
1: 6735
2: 2175
3: 1248
4: 1625
1089106297_1089106302 29 Left 1089106297 11:116008631-116008653 CCTCAATAAAATACTGGATTCGG No data
Right 1089106302 11:116008683-116008705 CTTATCCAACATGATCAAGTGGG 0: 82
1: 7619
2: 3862
3: 3153
4: 3227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089106297 Original CRISPR CCGAATCCAGTATTTTATTG AGG (reversed) Intergenic
No off target data available for this crispr