ID: 1089110964

View in Genome Browser
Species Human (GRCh38)
Location 11:116055730-116055752
Sequence CATGGTAACTCTGCAAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089110964_1089110971 5 Left 1089110964 11:116055730-116055752 CCTATGTTTGCAGAGTTACCATG No data
Right 1089110971 11:116055758-116055780 GAGGGGCCACGGGACCACTGTGG No data
1089110964_1089110968 -6 Left 1089110964 11:116055730-116055752 CCTATGTTTGCAGAGTTACCATG No data
Right 1089110968 11:116055747-116055769 ACCATGATAAAGAGGGGCCACGG No data
1089110964_1089110975 30 Left 1089110964 11:116055730-116055752 CCTATGTTTGCAGAGTTACCATG No data
Right 1089110975 11:116055783-116055805 GTGTCAGAGCTGCTCATTAGTGG No data
1089110964_1089110972 8 Left 1089110964 11:116055730-116055752 CCTATGTTTGCAGAGTTACCATG No data
Right 1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG No data
1089110964_1089110970 -5 Left 1089110964 11:116055730-116055752 CCTATGTTTGCAGAGTTACCATG No data
Right 1089110970 11:116055748-116055770 CCATGATAAAGAGGGGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089110964 Original CRISPR CATGGTAACTCTGCAAACAT AGG (reversed) Intergenic
No off target data available for this crispr