ID: 1089110969

View in Genome Browser
Species Human (GRCh38)
Location 11:116055748-116055770
Sequence CCCGTGGCCCCTCTTTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089110969_1089110980 28 Left 1089110969 11:116055748-116055770 CCATGATAAAGAGGGGCCACGGG No data
Right 1089110980 11:116055799-116055821 TTAGTGGAATGGGGTGTCTCGGG No data
1089110969_1089110972 -10 Left 1089110969 11:116055748-116055770 CCATGATAAAGAGGGGCCACGGG No data
Right 1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG No data
1089110969_1089110979 27 Left 1089110969 11:116055748-116055770 CCATGATAAAGAGGGGCCACGGG No data
Right 1089110979 11:116055798-116055820 ATTAGTGGAATGGGGTGTCTCGG No data
1089110969_1089110977 18 Left 1089110969 11:116055748-116055770 CCATGATAAAGAGGGGCCACGGG No data
Right 1089110977 11:116055789-116055811 GAGCTGCTCATTAGTGGAATGGG No data
1089110969_1089110978 19 Left 1089110969 11:116055748-116055770 CCATGATAAAGAGGGGCCACGGG No data
Right 1089110978 11:116055790-116055812 AGCTGCTCATTAGTGGAATGGGG No data
1089110969_1089110975 12 Left 1089110969 11:116055748-116055770 CCATGATAAAGAGGGGCCACGGG No data
Right 1089110975 11:116055783-116055805 GTGTCAGAGCTGCTCATTAGTGG No data
1089110969_1089110976 17 Left 1089110969 11:116055748-116055770 CCATGATAAAGAGGGGCCACGGG No data
Right 1089110976 11:116055788-116055810 AGAGCTGCTCATTAGTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089110969 Original CRISPR CCCGTGGCCCCTCTTTATCA TGG (reversed) Intergenic
No off target data available for this crispr