ID: 1089110972

View in Genome Browser
Species Human (GRCh38)
Location 11:116055761-116055783
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089110964_1089110972 8 Left 1089110964 11:116055730-116055752 CCTATGTTTGCAGAGTTACCATG No data
Right 1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG No data
1089110969_1089110972 -10 Left 1089110969 11:116055748-116055770 CCATGATAAAGAGGGGCCACGGG No data
Right 1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089110972 Original CRISPR GGGCCACGGGACCACTGTGG AGG Intergenic