ID: 1089111145

View in Genome Browser
Species Human (GRCh38)
Location 11:116057671-116057693
Sequence AATATCAGCAAGGATATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089111145_1089111147 7 Left 1089111145 11:116057671-116057693 CCATCTATATCCTTGCTGATATT No data
Right 1089111147 11:116057701-116057723 TTGTTCTGTCAGTTACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089111145 Original CRISPR AATATCAGCAAGGATATAGA TGG (reversed) Intergenic
No off target data available for this crispr