ID: 1089113968

View in Genome Browser
Species Human (GRCh38)
Location 11:116079062-116079084
Sequence GTCTCATCCCCTGCTCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089113963_1089113968 13 Left 1089113963 11:116079026-116079048 CCTAGTCTCCTCTCCATGGTGGC No data
Right 1089113968 11:116079062-116079084 GTCTCATCCCCTGCTCTTACAGG No data
1089113966_1089113968 0 Left 1089113966 11:116079039-116079061 CCATGGTGGCCTCTCTAAGGAGA No data
Right 1089113968 11:116079062-116079084 GTCTCATCCCCTGCTCTTACAGG No data
1089113967_1089113968 -9 Left 1089113967 11:116079048-116079070 CCTCTCTAAGGAGAGTCTCATCC No data
Right 1089113968 11:116079062-116079084 GTCTCATCCCCTGCTCTTACAGG No data
1089113964_1089113968 5 Left 1089113964 11:116079034-116079056 CCTCTCCATGGTGGCCTCTCTAA No data
Right 1089113968 11:116079062-116079084 GTCTCATCCCCTGCTCTTACAGG No data
1089113960_1089113968 19 Left 1089113960 11:116079020-116079042 CCTAGTCCTAGTCTCCTCTCCAT No data
Right 1089113968 11:116079062-116079084 GTCTCATCCCCTGCTCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089113968 Original CRISPR GTCTCATCCCCTGCTCTTAC AGG Intergenic
No off target data available for this crispr