ID: 1089114414

View in Genome Browser
Species Human (GRCh38)
Location 11:116082734-116082756
Sequence CTGGCCCCACAGATCTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089114408_1089114414 17 Left 1089114408 11:116082694-116082716 CCTTGCAGTCCAAGAGAGGAAAA No data
Right 1089114414 11:116082734-116082756 CTGGCCCCACAGATCTTCCTGGG No data
1089114409_1089114414 8 Left 1089114409 11:116082703-116082725 CCAAGAGAGGAAAAAGACAGAGA No data
Right 1089114414 11:116082734-116082756 CTGGCCCCACAGATCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089114414 Original CRISPR CTGGCCCCACAGATCTTCCT GGG Intergenic
No off target data available for this crispr