ID: 1089114913

View in Genome Browser
Species Human (GRCh38)
Location 11:116086917-116086939
Sequence GCAGATAGGGATCCCCGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089114913_1089114923 11 Left 1089114913 11:116086917-116086939 CCCACTCGGGGATCCCTATCTGC No data
Right 1089114923 11:116086951-116086973 CCACCACCCCTCGCTCTGTCTGG No data
1089114913_1089114929 27 Left 1089114913 11:116086917-116086939 CCCACTCGGGGATCCCTATCTGC No data
Right 1089114929 11:116086967-116086989 TGTCTGGTGTTGCCTGTTCAGGG No data
1089114913_1089114928 26 Left 1089114913 11:116086917-116086939 CCCACTCGGGGATCCCTATCTGC No data
Right 1089114928 11:116086966-116086988 CTGTCTGGTGTTGCCTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089114913 Original CRISPR GCAGATAGGGATCCCCGAGT GGG (reversed) Intergenic
No off target data available for this crispr