ID: 1089115828

View in Genome Browser
Species Human (GRCh38)
Location 11:116094310-116094332
Sequence GGGTTTCAACATATGGATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089115828_1089115835 23 Left 1089115828 11:116094310-116094332 CCCTAATCCATATGTTGAAACCC No data
Right 1089115835 11:116094356-116094378 AGAGATAATCACCTCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089115828 Original CRISPR GGGTTTCAACATATGGATTA GGG (reversed) Intergenic
No off target data available for this crispr