ID: 1089115835

View in Genome Browser
Species Human (GRCh38)
Location 11:116094356-116094378
Sequence AGAGATAATCACCTCTCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089115827_1089115835 30 Left 1089115827 11:116094303-116094325 CCTACTACCCTAATCCATATGTT No data
Right 1089115835 11:116094356-116094378 AGAGATAATCACCTCTCTAAAGG No data
1089115828_1089115835 23 Left 1089115828 11:116094310-116094332 CCCTAATCCATATGTTGAAACCC No data
Right 1089115835 11:116094356-116094378 AGAGATAATCACCTCTCTAAAGG No data
1089115831_1089115835 3 Left 1089115831 11:116094330-116094352 CCCTGACCTCCAATGTGACTGTA No data
Right 1089115835 11:116094356-116094378 AGAGATAATCACCTCTCTAAAGG No data
1089115833_1089115835 -3 Left 1089115833 11:116094336-116094358 CCTCCAATGTGACTGTATTTAGA 0: 12
1: 104
2: 315
3: 726
4: 1449
Right 1089115835 11:116094356-116094378 AGAGATAATCACCTCTCTAAAGG No data
1089115829_1089115835 22 Left 1089115829 11:116094311-116094333 CCTAATCCATATGTTGAAACCCT 0: 3
1: 71
2: 469
3: 1338
4: 4742
Right 1089115835 11:116094356-116094378 AGAGATAATCACCTCTCTAAAGG No data
1089115834_1089115835 -6 Left 1089115834 11:116094339-116094361 CCAATGTGACTGTATTTAGAGAT No data
Right 1089115835 11:116094356-116094378 AGAGATAATCACCTCTCTAAAGG No data
1089115830_1089115835 16 Left 1089115830 11:116094317-116094339 CCATATGTTGAAACCCTGACCTC No data
Right 1089115835 11:116094356-116094378 AGAGATAATCACCTCTCTAAAGG No data
1089115832_1089115835 2 Left 1089115832 11:116094331-116094353 CCTGACCTCCAATGTGACTGTAT No data
Right 1089115835 11:116094356-116094378 AGAGATAATCACCTCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089115835 Original CRISPR AGAGATAATCACCTCTCTAA AGG Intergenic
No off target data available for this crispr