ID: 1089116604

View in Genome Browser
Species Human (GRCh38)
Location 11:116100266-116100288
Sequence CATTCTGAAGAGCAGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089116599_1089116604 0 Left 1089116599 11:116100243-116100265 CCTGGGACTCAGGCACTGCCTAT No data
Right 1089116604 11:116100266-116100288 CATTCTGAAGAGCAGGGGTCAGG No data
1089116595_1089116604 20 Left 1089116595 11:116100223-116100245 CCAAGGTGATCTTAGTGATACCT No data
Right 1089116604 11:116100266-116100288 CATTCTGAAGAGCAGGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089116604 Original CRISPR CATTCTGAAGAGCAGGGGTC AGG Intergenic
No off target data available for this crispr