ID: 1089118399

View in Genome Browser
Species Human (GRCh38)
Location 11:116114321-116114343
Sequence GGGGGTGCCCTGACCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089118399_1089118410 20 Left 1089118399 11:116114321-116114343 CCAGTTTTGGTCAGGGCACCCCC No data
Right 1089118410 11:116114364-116114386 GCTGGAGTCAGACTGCAGATGGG No data
1089118399_1089118409 19 Left 1089118399 11:116114321-116114343 CCAGTTTTGGTCAGGGCACCCCC No data
Right 1089118409 11:116114363-116114385 TGCTGGAGTCAGACTGCAGATGG No data
1089118399_1089118406 2 Left 1089118399 11:116114321-116114343 CCAGTTTTGGTCAGGGCACCCCC No data
Right 1089118406 11:116114346-116114368 CCTTTCACCCACTCACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089118399 Original CRISPR GGGGGTGCCCTGACCAAAAC TGG (reversed) Intergenic
No off target data available for this crispr