ID: 1089118747

View in Genome Browser
Species Human (GRCh38)
Location 11:116117211-116117233
Sequence ATTGAGGAGCCCAATGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089118747_1089118753 18 Left 1089118747 11:116117211-116117233 CCATGACCATTGGGCTCCTCAAT No data
Right 1089118753 11:116117252-116117274 CCTGTGCTAGCTTAACTGTGGGG No data
1089118747_1089118754 27 Left 1089118747 11:116117211-116117233 CCATGACCATTGGGCTCCTCAAT No data
Right 1089118754 11:116117261-116117283 GCTTAACTGTGGGGTGCTTCTGG No data
1089118747_1089118751 17 Left 1089118747 11:116117211-116117233 CCATGACCATTGGGCTCCTCAAT No data
Right 1089118751 11:116117251-116117273 TCCTGTGCTAGCTTAACTGTGGG No data
1089118747_1089118750 16 Left 1089118747 11:116117211-116117233 CCATGACCATTGGGCTCCTCAAT No data
Right 1089118750 11:116117250-116117272 CTCCTGTGCTAGCTTAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089118747 Original CRISPR ATTGAGGAGCCCAATGGTCA TGG (reversed) Intergenic
No off target data available for this crispr