ID: 1089120424

View in Genome Browser
Species Human (GRCh38)
Location 11:116130628-116130650
Sequence CAGTAGAGAAAGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089120424_1089120428 -6 Left 1089120424 11:116130628-116130650 CCTGCCTCCTCCTTTCTCTACTG No data
Right 1089120428 11:116130645-116130667 CTACTGCCCGAGATCCTGACAGG No data
1089120424_1089120429 -5 Left 1089120424 11:116130628-116130650 CCTGCCTCCTCCTTTCTCTACTG No data
Right 1089120429 11:116130646-116130668 TACTGCCCGAGATCCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089120424 Original CRISPR CAGTAGAGAAAGGAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr