ID: 1089120424 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:116130628-116130650 |
| Sequence | CAGTAGAGAAAGGAGGAGGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1089120424_1089120428 | -6 | Left | 1089120424 | 11:116130628-116130650 | CCTGCCTCCTCCTTTCTCTACTG | No data | ||
| Right | 1089120428 | 11:116130645-116130667 | CTACTGCCCGAGATCCTGACAGG | No data | ||||
| 1089120424_1089120429 | -5 | Left | 1089120424 | 11:116130628-116130650 | CCTGCCTCCTCCTTTCTCTACTG | No data | ||
| Right | 1089120429 | 11:116130646-116130668 | TACTGCCCGAGATCCTGACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1089120424 | Original CRISPR | CAGTAGAGAAAGGAGGAGGC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||