ID: 1089124854

View in Genome Browser
Species Human (GRCh38)
Location 11:116169685-116169707
Sequence AGCTTTGCAGAGATGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089124854_1089124861 12 Left 1089124854 11:116169685-116169707 CCCCTCTCCATCTCTGCAAAGCT No data
Right 1089124861 11:116169720-116169742 GACAGCTTCAGAAACCATGCTGG No data
1089124854_1089124862 13 Left 1089124854 11:116169685-116169707 CCCCTCTCCATCTCTGCAAAGCT No data
Right 1089124862 11:116169721-116169743 ACAGCTTCAGAAACCATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089124854 Original CRISPR AGCTTTGCAGAGATGGAGAG GGG (reversed) Intergenic
No off target data available for this crispr