ID: 1089127371

View in Genome Browser
Species Human (GRCh38)
Location 11:116186202-116186224
Sequence GTGGCTCCGACCGGTTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089127367_1089127371 26 Left 1089127367 11:116186153-116186175 CCAGGATGCTTTGTTCAAGGTCA No data
Right 1089127371 11:116186202-116186224 GTGGCTCCGACCGGTTGTCCTGG No data
1089127366_1089127371 27 Left 1089127366 11:116186152-116186174 CCCAGGATGCTTTGTTCAAGGTC No data
Right 1089127371 11:116186202-116186224 GTGGCTCCGACCGGTTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089127371 Original CRISPR GTGGCTCCGACCGGTTGTCC TGG Intergenic
No off target data available for this crispr