ID: 1089127852

View in Genome Browser
Species Human (GRCh38)
Location 11:116190022-116190044
Sequence TCTCAGGAGCTGGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089127841_1089127852 21 Left 1089127841 11:116189978-116190000 CCCTTTATTTCAAATTCTCAGCA No data
Right 1089127852 11:116190022-116190044 TCTCAGGAGCTGGGGGTGGAGGG No data
1089127844_1089127852 -3 Left 1089127844 11:116190002-116190024 CCTTTGCTGGATCTGCTGAATCT No data
Right 1089127852 11:116190022-116190044 TCTCAGGAGCTGGGGGTGGAGGG No data
1089127842_1089127852 20 Left 1089127842 11:116189979-116190001 CCTTTATTTCAAATTCTCAGCAG No data
Right 1089127852 11:116190022-116190044 TCTCAGGAGCTGGGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089127852 Original CRISPR TCTCAGGAGCTGGGGGTGGA GGG Intergenic
No off target data available for this crispr