ID: 1089131297

View in Genome Browser
Species Human (GRCh38)
Location 11:116214390-116214412
Sequence CATGGTTTAGAATCCATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089131297_1089131303 3 Left 1089131297 11:116214390-116214412 CCTACAATGGATTCTAAACCATG No data
Right 1089131303 11:116214416-116214438 TTGTATGCCCCATATTATTAGGG No data
1089131297_1089131307 23 Left 1089131297 11:116214390-116214412 CCTACAATGGATTCTAAACCATG No data
Right 1089131307 11:116214436-116214458 GGGAAGAAACATCATTATTATGG No data
1089131297_1089131302 2 Left 1089131297 11:116214390-116214412 CCTACAATGGATTCTAAACCATG No data
Right 1089131302 11:116214415-116214437 GTTGTATGCCCCATATTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089131297 Original CRISPR CATGGTTTAGAATCCATTGT AGG (reversed) Intergenic