ID: 1089131302

View in Genome Browser
Species Human (GRCh38)
Location 11:116214415-116214437
Sequence GTTGTATGCCCCATATTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089131295_1089131302 11 Left 1089131295 11:116214381-116214403 CCGCACTGCCCTACAATGGATTC No data
Right 1089131302 11:116214415-116214437 GTTGTATGCCCCATATTATTAGG No data
1089131297_1089131302 2 Left 1089131297 11:116214390-116214412 CCTACAATGGATTCTAAACCATG No data
Right 1089131302 11:116214415-116214437 GTTGTATGCCCCATATTATTAGG No data
1089131293_1089131302 15 Left 1089131293 11:116214377-116214399 CCTTCCGCACTGCCCTACAATGG No data
Right 1089131302 11:116214415-116214437 GTTGTATGCCCCATATTATTAGG No data
1089131296_1089131302 3 Left 1089131296 11:116214389-116214411 CCCTACAATGGATTCTAAACCAT No data
Right 1089131302 11:116214415-116214437 GTTGTATGCCCCATATTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089131302 Original CRISPR GTTGTATGCCCCATATTATT AGG Intergenic