ID: 1089131307

View in Genome Browser
Species Human (GRCh38)
Location 11:116214436-116214458
Sequence GGGAAGAAACATCATTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089131297_1089131307 23 Left 1089131297 11:116214390-116214412 CCTACAATGGATTCTAAACCATG No data
Right 1089131307 11:116214436-116214458 GGGAAGAAACATCATTATTATGG No data
1089131301_1089131307 5 Left 1089131301 11:116214408-116214430 CCATGGGGTTGTATGCCCCATAT No data
Right 1089131307 11:116214436-116214458 GGGAAGAAACATCATTATTATGG No data
1089131296_1089131307 24 Left 1089131296 11:116214389-116214411 CCCTACAATGGATTCTAAACCAT No data
Right 1089131307 11:116214436-116214458 GGGAAGAAACATCATTATTATGG No data
1089131304_1089131307 -10 Left 1089131304 11:116214423-116214445 CCCCATATTATTAGGGAAGAAAC No data
Right 1089131307 11:116214436-116214458 GGGAAGAAACATCATTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089131307 Original CRISPR GGGAAGAAACATCATTATTA TGG Intergenic