ID: 1089133397

View in Genome Browser
Species Human (GRCh38)
Location 11:116230056-116230078
Sequence ATGTTTAAGTGAAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089133393_1089133397 24 Left 1089133393 11:116230009-116230031 CCTCAGTTTCATTAGCAACTCAA No data
Right 1089133397 11:116230056-116230078 ATGTTTAAGTGAAATGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089133397 Original CRISPR ATGTTTAAGTGAAATGTGGA GGG Intergenic
No off target data available for this crispr