ID: 1089133639

View in Genome Browser
Species Human (GRCh38)
Location 11:116232108-116232130
Sequence CTGCTTGAAGGGCTGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089133639_1089133646 -2 Left 1089133639 11:116232108-116232130 CCTTCCCCCAGCCCTTCAAGCAG No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089133639 Original CRISPR CTGCTTGAAGGGCTGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr