ID: 1089133646

View in Genome Browser
Species Human (GRCh38)
Location 11:116232129-116232151
Sequence AGAACAGTCTGTGTATACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089133638_1089133646 1 Left 1089133638 11:116232105-116232127 CCTCCTTCCCCCAGCCCTTCAAG No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133633_1089133646 18 Left 1089133633 11:116232088-116232110 CCATCTACCCACTCCCACCTCCT No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133631_1089133646 20 Left 1089133631 11:116232086-116232108 CCCCATCTACCCACTCCCACCTC No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133634_1089133646 11 Left 1089133634 11:116232095-116232117 CCCACTCCCACCTCCTTCCCCCA No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133641_1089133646 -7 Left 1089133641 11:116232113-116232135 CCCCAGCCCTTCAAGCAGAACAG No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133637_1089133646 4 Left 1089133637 11:116232102-116232124 CCACCTCCTTCCCCCAGCCCTTC No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133632_1089133646 19 Left 1089133632 11:116232087-116232109 CCCATCTACCCACTCCCACCTCC No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133640_1089133646 -6 Left 1089133640 11:116232112-116232134 CCCCCAGCCCTTCAAGCAGAACA No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133643_1089133646 -9 Left 1089133643 11:116232115-116232137 CCAGCCCTTCAAGCAGAACAGTC No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133635_1089133646 10 Left 1089133635 11:116232096-116232118 CCACTCCCACCTCCTTCCCCCAG No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133636_1089133646 5 Left 1089133636 11:116232101-116232123 CCCACCTCCTTCCCCCAGCCCTT No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133639_1089133646 -2 Left 1089133639 11:116232108-116232130 CCTTCCCCCAGCCCTTCAAGCAG No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data
1089133642_1089133646 -8 Left 1089133642 11:116232114-116232136 CCCAGCCCTTCAAGCAGAACAGT No data
Right 1089133646 11:116232129-116232151 AGAACAGTCTGTGTATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089133646 Original CRISPR AGAACAGTCTGTGTATACTT TGG Intergenic
No off target data available for this crispr