ID: 1089137701

View in Genome Browser
Species Human (GRCh38)
Location 11:116262996-116263018
Sequence GTGTTCTTTGATTGGATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089137695_1089137701 14 Left 1089137695 11:116262959-116262981 CCAGGTTCTAGAAGACCTTAAAT No data
Right 1089137701 11:116262996-116263018 GTGTTCTTTGATTGGATCCCAGG No data
1089137697_1089137701 -1 Left 1089137697 11:116262974-116262996 CCTTAAATGTCCCACTATGGATG No data
Right 1089137701 11:116262996-116263018 GTGTTCTTTGATTGGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089137701 Original CRISPR GTGTTCTTTGATTGGATCCC AGG Intergenic
No off target data available for this crispr