ID: 1089138281

View in Genome Browser
Species Human (GRCh38)
Location 11:116266713-116266735
Sequence GAACCCAAGGTTCCACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089138281_1089138288 30 Left 1089138281 11:116266713-116266735 CCCAGCTGTGGAACCTTGGGTTC No data
Right 1089138288 11:116266766-116266788 TCTTCATATGCATACCTCAGAGG No data
1089138281_1089138285 -4 Left 1089138281 11:116266713-116266735 CCCAGCTGTGGAACCTTGGGTTC No data
Right 1089138285 11:116266732-116266754 GTTCCTGACCTAGACTTTCAGGG No data
1089138281_1089138284 -5 Left 1089138281 11:116266713-116266735 CCCAGCTGTGGAACCTTGGGTTC No data
Right 1089138284 11:116266731-116266753 GGTTCCTGACCTAGACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089138281 Original CRISPR GAACCCAAGGTTCCACAGCT GGG (reversed) Intergenic
No off target data available for this crispr